Mutagenetix > Incidental Mutation

Incidental Mutation 'R6476:Dnah14'

516758

Institutional Source

Beutler Lab

Gene Symbol

Dnah14

Ensembl Gene

ENSMUSG00000047369

Gene Name

dynein, axonemal, heavy chain 14

Synonyms

Dnahc14, Gm980, LOC381311, A230079K17Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R6476 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

181576559-181815774 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 181744768 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 2888 (E2888G)

Ref Sequence

ENSEMBL: ENSMUSP00000146843 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000208001]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000097446

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160345

SMART Domains

Protein: ENSMUSP00000124817
Gene: ENSMUSG00000047369

Domain	Start	End	E-Value	Type
Pfam:MT	46	381	2.1e-41	PFAM
Pfam:AAA_9	401	524	8.3e-35	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160793

Predicted Effect

probably benign
Transcript: ENSMUST00000208001
AA Change: E2888G

PolyPhen 2 Score 0.256 (Sensitivity: 0.91; Specificity: 0.88)

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020D05Rik	A	C	19: 5,503,225	I176S	probably damaging	Het
a	T	C	2: 155,050,779	V126A	probably benign	Het
Adamts20	T	C	15: 94,361,810	Q336R	probably benign	Het
Ankrd36	A	G	11: 5,628,753	T6A	probably benign	Het
Arhgap33	A	G	7: 30,524,412	S731P	probably damaging	Het
Arhgef10l	G	C	4: 140,611,382	P23R	probably damaging	Het
Atf7	T	C	15: 102,593,712	D3G	probably benign	Het
Caps2	A	G	10: 112,175,560	T30A	possibly damaging	Het
Ccdc15	A	T	9: 37,342,419	I191N	probably benign	Het
Cep170	A	T	1: 176,780,351	S180T	possibly damaging	Het
Chd1	G	A	17: 17,380,988		probably null	Het
Col6a3	A	T	1: 90,781,812	N1887K	unknown	Het
Csgalnact1	C	T	8: 68,461,109	S148N	probably damaging	Het
Csgalnact1	T	A	8: 68,461,110	S148C	probably damaging	Het
D10Jhu81e	T	C	10: 78,167,513	N102D	probably damaging	Het
Dnah7b	T	A	1: 46,242,204	Y2808*	probably null	Het
Dock10	A	C	1: 80,541,242	L1254*	probably null	Het
Eml2	T	C	7: 19,196,311	V511A	probably benign	Het
Eml6	A	G	11: 29,791,971		probably null	Het
Erbin	C	A	13: 103,841,247	D601Y	probably damaging	Het
Fam35a	T	C	14: 34,268,014	S312G	probably benign	Het
Farsa	A	G	8: 84,857,180	E49G	probably damaging	Het
Fzd7	A	G	1: 59,483,995	M346V	probably damaging	Het
Glg1	A	C	8: 111,200,174	S170A	possibly damaging	Het
Gm21994	T	C	2: 150,255,326	D61G	probably benign	Het
Gm340	C	T	19: 41,583,079	T237I	probably benign	Het
Gpx3	A	T	11: 54,907,199	I54F	probably damaging	Het
H6pd	G	A	4: 149,982,727	H401Y	probably damaging	Het
Hspb8	A	G	5: 116,422,398	S28P	probably damaging	Het
Iqub	T	A	6: 24,449,745	N707I	probably damaging	Het
Krt9	A	T	11: 100,190,814	D296E	probably damaging	Het
Lnx1	A	G	5: 74,607,880	V349A	possibly damaging	Het
Map3k6	A	T	4: 133,250,086	S915C	probably damaging	Het
Mecom	C	A	3: 29,980,568	A510S	possibly damaging	Het
Mettl14	A	G	3: 123,374,037	I224T	probably damaging	Het
Mme	T	C	3: 63,343,635		probably null	Het
Nbea	T	A	3: 56,004,806	T1187S	probably benign	Het
Ndor1	T	C	2: 25,248,142	T444A	possibly damaging	Het
Nhlrc1	A	G	13: 47,014,181	L200P	possibly damaging	Het
Npc1	G	T	18: 12,201,694	S667*	probably null	Het
Olfr1009	T	A	2: 85,721,584	Y60N	probably damaging	Het
Olfr1214	T	A	2: 88,987,377	D275V	probably benign	Het
Olfr294	C	T	7: 86,616,010	V212I	probably benign	Het
Olfr355	T	A	2: 36,927,583	H177L	possibly damaging	Het
Olfr557	T	A	7: 102,699,103	N288K	possibly damaging	Het
Pds5a	A	C	5: 65,634,287	I773R	possibly damaging	Het
Pgr	T	A	9: 8,964,838		probably null	Het
Plscr4	A	T	9: 92,490,766	M314L	probably benign	Het
Polr2m	A	G	9: 71,483,470	V46A	probably benign	Het
Ptk2b	T	A	14: 66,187,474	M174L	possibly damaging	Het
Sec31a	A	T	5: 100,386,149	F521I	probably benign	Het
Serpinb3d	T	C	1: 107,083,341	N47S	probably benign	Het
Slc17a2	C	A	13: 23,812,586	H25N	probably damaging	Het
Slc24a3	T	A	2: 145,606,830	D431E	probably benign	Het
Slc9a9	T	C	9: 94,685,138	F87L	probably benign	Het
Spata31	T	A	13: 64,917,642	S54T	possibly damaging	Het
Spata6	T	C	4: 111,774,823	S144P	probably damaging	Het
Sppl2c	A	G	11: 104,186,769	N132D	probably benign	Het
Ssu2	C	T	6: 112,374,832	G311S	probably damaging	Het
Syne1	T	A	10: 5,154,531	Q6328L	possibly damaging	Het
Tie1	T	C	4: 118,472,865	T1054A	possibly damaging	Het
Tnfaip6	T	G	2: 52,052,316	D212E	probably benign	Het
Tnxb	A	G	17: 34,690,192	T1442A	probably damaging	Het
Trim35	C	T	14: 66,308,795	T337M	probably damaging	Het
Vipr1	T	C	9: 121,669,423	V413A	probably benign	Het
Vmn1r19	C	G	6: 57,404,593	Q44E	probably damaging	Het
Zfp266	G	T	9: 20,499,281	H533Q	probably damaging	Het
Zfp689	T	C	7: 127,444,724	S245G	probably damaging	Het

Other mutations in Dnah14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01086:Dnah14	APN	1	181752046	missense	probably benign	0.17
IGL01764:Dnah14	APN	1	181744777	missense	probably benign	0.00
IGL03218:Dnah14	APN	1	181755269	missense	probably benign	0.02
IGL03290:Dnah14	APN	1	181763978	splice site	probably benign
IGL03384:Dnah14	APN	1	181745949	missense	probably benign	0.03
R0009:Dnah14	UTSW	1	181769407	splice site	probably benign
R0125:Dnah14	UTSW	1	181752063	missense	probably damaging	0.99
R0579:Dnah14	UTSW	1	181744747	missense	possibly damaging	0.72
R0973:Dnah14	UTSW	1	181752145	missense	probably damaging	1.00
R0973:Dnah14	UTSW	1	181752145	missense	probably damaging	1.00
R0974:Dnah14	UTSW	1	181752145	missense	probably damaging	1.00
R1609:Dnah14	UTSW	1	181750177	missense	probably damaging	0.97
R1860:Dnah14	UTSW	1	181763960	missense	probably damaging	1.00
R2050:Dnah14	UTSW	1	181752562	missense	probably damaging	1.00
R2974:Dnah14	UTSW	1	181755241	critical splice acceptor site	probably null
R4715:Dnah14	UTSW	1	181757223	missense	probably damaging	1.00
R5076:Dnah14	UTSW	1	181757234	missense	probably benign	0.01
R5424:Dnah14	UTSW	1	181763310	missense	possibly damaging	0.95
R5808:Dnah14	UTSW	1	181741159	missense	possibly damaging	0.72
R5997:Dnah14	UTSW	1	181770105	missense	probably benign	0.00
R6052:Dnah14	UTSW	1	181666487	missense	possibly damaging	0.50
R6061:Dnah14	UTSW	1	181709051	missense	probably damaging	1.00
R6089:Dnah14	UTSW	1	181750154	missense	probably damaging	1.00
R6092:Dnah14	UTSW	1	181621833	missense	probably benign	0.13
R6145:Dnah14	UTSW	1	181666417	missense	probably benign	0.00
R6163:Dnah14	UTSW	1	181666361	missense	probably benign	0.33
R6246:Dnah14	UTSW	1	181680888	missense	probably benign	0.00
R6302:Dnah14	UTSW	1	181601206	missense	possibly damaging	0.96
R6306:Dnah14	UTSW	1	181585024	frame shift	probably null
R6326:Dnah14	UTSW	1	181783556	missense	probably damaging	1.00
R6348:Dnah14	UTSW	1	181626720	missense	possibly damaging	0.83
R6367:Dnah14	UTSW	1	181755386	splice site	probably null
R6376:Dnah14	UTSW	1	181605894	missense	possibly damaging	0.79
R6389:Dnah14	UTSW	1	181651202	critical splice donor site	probably null
R6433:Dnah14	UTSW	1	181651657	missense	probably damaging	0.99
R6454:Dnah14	UTSW	1	181783705	missense	probably damaging	1.00
R6523:Dnah14	UTSW	1	181643621	missense	probably benign	0.00
R6529:Dnah14	UTSW	1	181666469	missense	probably damaging	0.98
R6538:Dnah14	UTSW	1	181584985	missense	unknown
R6546:Dnah14	UTSW	1	181738987	missense	probably damaging	1.00
R6752:Dnah14	UTSW	1	181593452	missense	probably benign	0.07
R6762:Dnah14	UTSW	1	181757259	missense	probably damaging	1.00
R6786:Dnah14	UTSW	1	181641405	missense	probably benign	0.21
R6849:Dnah14	UTSW	1	181808945	missense	probably benign	0.00
R6877:Dnah14	UTSW	1	181628432	missense	possibly damaging	0.82
R6912:Dnah14	UTSW	1	181750183	missense	possibly damaging	0.83
R6919:Dnah14	UTSW	1	181585066	missense	probably benign	0.04
R6924:Dnah14	UTSW	1	181627952	missense	probably benign	0.04
R6957:Dnah14	UTSW	1	181785175	missense	possibly damaging	0.92
R6980:Dnah14	UTSW	1	181648230	missense	probably benign	0.00
R7018:Dnah14	UTSW	1	181626944	missense	possibly damaging	0.55
R7046:Dnah14	UTSW	1	181623003	missense	probably benign	0.01
R7058:Dnah14	UTSW	1	181698049	missense	probably benign	0.00
R7068:Dnah14	UTSW	1	181769790	missense	probably benign	0.35
R7115:Dnah14	UTSW	1	181720145	missense	probably damaging	1.00
R7130:Dnah14	UTSW	1	181745958	nonsense	probably null
R7165:Dnah14	UTSW	1	181704535	missense	probably benign	0.00
R7169:Dnah14	UTSW	1	181702365	missense	probably benign	0.00
R7184:Dnah14	UTSW	1	181704529	nonsense	probably null
R7232:Dnah14	UTSW	1	181757363	missense	probably damaging	1.00
R7260:Dnah14	UTSW	1	181706744	missense	probably damaging	0.99
R7276:Dnah14	UTSW	1	181685807	missense	probably benign	0.41
R7290:Dnah14	UTSW	1	181628174	missense	probably benign	0.20
R7314:Dnah14	UTSW	1	181785254	splice site	probably null
R7326:Dnah14	UTSW	1	181598403	missense	probably benign	0.02
R7336:Dnah14	UTSW	1	181797734	missense	probably damaging	0.96
R7363:Dnah14	UTSW	1	181690524	splice site	probably null
R7371:Dnah14	UTSW	1	181626885	missense	probably benign	0.05
R7376:Dnah14	UTSW	1	181763402	missense	probably benign	0.03
R7418:Dnah14	UTSW	1	181616742	missense	possibly damaging	0.92
R7473:Dnah14	UTSW	1	181752139	missense	probably damaging	0.99
R7514:Dnah14	UTSW	1	181628067	missense	probably damaging	0.96
R7555:Dnah14	UTSW	1	181770054	missense	probably benign	0.26
R7641:Dnah14	UTSW	1	181707533	missense	probably benign	0.01
R7663:Dnah14	UTSW	1	181752155	splice site	probably null
R7674:Dnah14	UTSW	1	181707533	missense	probably benign	0.01
R7680:Dnah14	UTSW	1	181685800	missense	probably benign	0.15
R7709:Dnah14	UTSW	1	181702484	critical splice donor site	probably null
R7842:Dnah14	UTSW	1	181627898	missense	probably damaging	0.99
R7861:Dnah14	UTSW	1	181616759	missense	probably damaging	1.00
R7988:Dnah14	UTSW	1	181783574	missense	probably damaging	0.97
R8016:Dnah14	UTSW	1	181648311	missense	probably benign	0.05
R8042:Dnah14	UTSW	1	181643631	critical splice donor site	probably null
R8071:Dnah14	UTSW	1	181615894	missense	possibly damaging	0.84
R8086:Dnah14	UTSW	1	181766232	missense	probably damaging	1.00
R8095:Dnah14	UTSW	1	181806032	nonsense	probably null
R8139:Dnah14	UTSW	1	181755288	missense	probably damaging	1.00
R8176:Dnah14	UTSW	1	181657033	missense	probably damaging	0.96
R8193:Dnah14	UTSW	1	181688205	missense	probably damaging	1.00
R8197:Dnah14	UTSW	1	181690101	missense	possibly damaging	0.94
R8209:Dnah14	UTSW	1	181795545	missense	possibly damaging	0.69
R8226:Dnah14	UTSW	1	181795545	missense	possibly damaging	0.69
R8251:Dnah14	UTSW	1	181664865	missense	probably damaging	1.00
R8264:Dnah14	UTSW	1	181744792	missense	probably damaging	0.99
R8284:Dnah14	UTSW	1	181773811	missense	probably benign	0.03
R8289:Dnah14	UTSW	1	181716215	nonsense	probably null
R8323:Dnah14	UTSW	1	181704544	missense	probably benign	0.01
R8442:Dnah14	UTSW	1	181741284	missense	probably damaging	0.97
R8458:Dnah14	UTSW	1	181806012	missense
R8507:Dnah14	UTSW	1	181641414	missense	probably benign	0.02
R8509:Dnah14	UTSW	1	181814655	missense
R8520:Dnah14	UTSW	1	181653638	missense	probably damaging	1.00
R8530:Dnah14	UTSW	1	181664946	missense	probably damaging	1.00
R8703:Dnah14	UTSW	1	181666011	nonsense	probably null
R8710:Dnah14	UTSW	1	181690311	missense	probably benign	0.04
R8752:Dnah14	UTSW	1	181628016	missense	probably benign	0.00
R8792:Dnah14	UTSW	1	181814624	missense
R8797:Dnah14	UTSW	1	181637847	missense	probably benign	0.19
R8821:Dnah14	UTSW	1	181792004	nonsense	probably null
R8834:Dnah14	UTSW	1	181616750	missense	possibly damaging	0.83
R8913:Dnah14	UTSW	1	181725498	missense	probably benign	0.01
R8925:Dnah14	UTSW	1	181680756	missense	probably damaging	1.00
R8927:Dnah14	UTSW	1	181680756	missense	probably damaging	1.00
R8934:Dnah14	UTSW	1	181622723	missense	possibly damaging	0.84
R9090:Dnah14	UTSW	1	181769760	missense	probably benign	0.33
R9169:Dnah14	UTSW	1	181605816	missense	probably benign	0.06
R9199:Dnah14	UTSW	1	181651001	missense	possibly damaging	0.50
R9212:Dnah14	UTSW	1	181801287	missense	possibly damaging	0.95
R9213:Dnah14	UTSW	1	181616640	critical splice donor site	probably null
R9271:Dnah14	UTSW	1	181769760	missense	probably benign	0.33
R9282:Dnah14	UTSW	1	181814512	missense
R9350:Dnah14	UTSW	1	181734804	missense	possibly damaging	0.79
R9358:Dnah14	UTSW	1	181709033	missense	probably benign	0.01
R9436:Dnah14	UTSW	1	181680783	missense	probably damaging	1.00
R9484:Dnah14	UTSW	1	181690208	missense	probably benign	0.45
R9484:Dnah14	UTSW	1	181797746	missense	probably benign	0.01
R9486:Dnah14	UTSW	1	181680929	missense	possibly damaging	0.68
R9546:Dnah14	UTSW	1	181593427	critical splice acceptor site	probably null
R9547:Dnah14	UTSW	1	181593427	critical splice acceptor site	probably null
R9578:Dnah14	UTSW	1	181674442	missense	probably benign	0.16
R9654:Dnah14	UTSW	1	181766339	missense	probably benign	0.01
R9681:Dnah14	UTSW	1	181734849	missense	possibly damaging	0.91
R9683:Dnah14	UTSW	1	181598944	missense	probably benign	0.01
R9687:Dnah14	UTSW	1	181598413	missense	probably benign	0.01
R9718:Dnah14	UTSW	1	181622979	missense	probably benign	0.08
R9751:Dnah14	UTSW	1	181792045	missense	probably damaging	1.00
R9757:Dnah14	UTSW	1	181685784	missense	probably benign	0.03
RF007:Dnah14	UTSW	1	181685809	missense	probably benign	0.00
RF012:Dnah14	UTSW	1	181627898	missense	probably damaging	0.99
Z1176:Dnah14	UTSW	1	181757351	missense	possibly damaging	0.83
Z1177:Dnah14	UTSW	1	181690320	missense	probably benign	0.03
Z1177:Dnah14	UTSW	1	181763334	missense	probably damaging	1.00
Z1177:Dnah14	UTSW	1	181766304	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAGAGCTCTGAGAGTTTGAGAGTT -3'
(R):5'- GTATAACTGGGATCCCACAAGG -3'

Sequencing Primer
(F):5'- AGCTCTGAGAGTTTGAGAGTTTAGAG -3'
(R):5'- AAAGCAGTGTTCCTCCATGG -3'

Posted On

2018-05-21