Incidental Mutation 'R6476:Map3k6'
ID 516773
Institutional Source Beutler Lab
Gene Symbol Map3k6
Ensembl Gene ENSMUSG00000028862
Gene Name mitogen-activated protein kinase kinase kinase 6
Synonyms Ask2, MEKK6, MAPKKK6
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.324) question?
Stock # R6476 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 132968129-132980240 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 132977397 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 915 (S915C)
Ref Sequence ENSEMBL: ENSMUSP00000030677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030674] [ENSMUST00000030677] [ENSMUST00000105908]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000030674
SMART Domains Protein: ENSMUSP00000030674
Gene: ENSMUSG00000028860

DomainStartEndE-ValueType
PDB:3BC1|F 40 92 2e-9 PDB
low complexity region 169 183 N/A INTRINSIC
low complexity region 235 262 N/A INTRINSIC
C2 288 389 2.36e-17 SMART
C2 429 532 6.96e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000030677
AA Change: S915C

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030677
Gene: ENSMUSG00000028862
AA Change: S915C

DomainStartEndE-ValueType
low complexity region 98 109 N/A INTRINSIC
Pfam:DUF4071 130 508 2.3e-150 PFAM
S_TKc 649 907 3.49e-87 SMART
low complexity region 925 940 N/A INTRINSIC
low complexity region 947 960 N/A INTRINSIC
low complexity region 975 990 N/A INTRINSIC
low complexity region 1130 1146 N/A INTRINSIC
coiled coil region 1164 1195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105908
SMART Domains Protein: ENSMUSP00000101528
Gene: ENSMUSG00000028860

DomainStartEndE-ValueType
PDB:3BC1|F 40 92 2e-9 PDB
low complexity region 157 171 N/A INTRINSIC
low complexity region 223 250 N/A INTRINSIC
C2 276 359 3.15e-4 SMART
C2 364 467 6.96e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127681
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142039
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase that forms a component of protein kinase-mediated signal transduction cascades. The encoded kinase participates in the regulation of vascular endothelial growth factor (VEGF) expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous and heterozygous null mice display an increased incidence of chemically induced skin tumors and homozygous mice also show resistance to induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
a T C 2: 154,892,699 (GRCm39) V126A probably benign Het
Adamts20 T C 15: 94,259,691 (GRCm39) Q336R probably benign Het
Ankrd36 A G 11: 5,578,753 (GRCm39) T6A probably benign Het
Arhgap33 A G 7: 30,223,837 (GRCm39) S731P probably damaging Het
Arhgef10l G C 4: 140,338,693 (GRCm39) P23R probably damaging Het
Atf7 T C 15: 102,502,147 (GRCm39) D3G probably benign Het
Caps2 A G 10: 112,011,465 (GRCm39) T30A possibly damaging Het
Ccdc15 A T 9: 37,253,715 (GRCm39) I191N probably benign Het
Cep170 A T 1: 176,607,917 (GRCm39) S180T possibly damaging Het
Chd1 G A 17: 17,601,250 (GRCm39) probably null Het
Col6a3 A T 1: 90,709,534 (GRCm39) N1887K unknown Het
Csgalnact1 C T 8: 68,913,761 (GRCm39) S148N probably damaging Het
Csgalnact1 T A 8: 68,913,762 (GRCm39) S148C probably damaging Het
Dnah14 A G 1: 181,572,333 (GRCm39) E2888G probably benign Het
Dnah7b T A 1: 46,281,364 (GRCm39) Y2808* probably null Het
Dock10 A C 1: 80,518,959 (GRCm39) L1254* probably null Het
Eml2 T C 7: 18,930,236 (GRCm39) V511A probably benign Het
Eml6 A G 11: 29,741,971 (GRCm39) probably null Het
Erbin C A 13: 103,977,755 (GRCm39) D601Y probably damaging Het
Farsa A G 8: 85,583,809 (GRCm39) E49G probably damaging Het
Fzd7 A G 1: 59,523,154 (GRCm39) M346V probably damaging Het
Gatd3a T C 10: 78,003,347 (GRCm39) N102D probably damaging Het
Glg1 A C 8: 111,926,806 (GRCm39) S170A possibly damaging Het
Gpx3 A T 11: 54,798,025 (GRCm39) I54F probably damaging Het
H6pd G A 4: 150,067,184 (GRCm39) H401Y probably damaging Het
Hspb8 A G 5: 116,560,457 (GRCm39) S28P probably damaging Het
Iqub T A 6: 24,449,744 (GRCm39) N707I probably damaging Het
Krt9 A T 11: 100,081,640 (GRCm39) D296E probably damaging Het
Lcor C T 19: 41,571,518 (GRCm39) T237I probably benign Het
Lnx1 A G 5: 74,768,541 (GRCm39) V349A possibly damaging Het
Mecom C A 3: 30,034,717 (GRCm39) A510S possibly damaging Het
Mettl14 A G 3: 123,167,686 (GRCm39) I224T probably damaging Het
Mme T C 3: 63,251,056 (GRCm39) probably null Het
Nbea T A 3: 55,912,227 (GRCm39) T1187S probably benign Het
Ndor1 T C 2: 25,138,154 (GRCm39) T444A possibly damaging Het
Nhlrc1 A G 13: 47,167,657 (GRCm39) L200P possibly damaging Het
Npc1 G T 18: 12,334,751 (GRCm39) S667* probably null Het
Nscme3l A C 19: 5,553,253 (GRCm39) I176S probably damaging Het
Or14a256 C T 7: 86,265,218 (GRCm39) V212I probably benign Het
Or1l8 T A 2: 36,817,595 (GRCm39) H177L possibly damaging Het
Or4c109 T A 2: 88,817,721 (GRCm39) D275V probably benign Het
Or51d1 T A 7: 102,348,310 (GRCm39) N288K possibly damaging Het
Or5g9 T A 2: 85,551,928 (GRCm39) Y60N probably damaging Het
Pds5a A C 5: 65,791,630 (GRCm39) I773R possibly damaging Het
Pgr T A 9: 8,964,839 (GRCm39) probably null Het
Plscr4 A T 9: 92,372,819 (GRCm39) M314L probably benign Het
Polr2m A G 9: 71,390,752 (GRCm39) V46A probably benign Het
Ptk2b T A 14: 66,424,923 (GRCm39) M174L possibly damaging Het
Sec31a A T 5: 100,534,008 (GRCm39) F521I probably benign Het
Serpinb3d T C 1: 107,011,071 (GRCm39) N47S probably benign Het
Shld2 T C 14: 33,989,971 (GRCm39) S312G probably benign Het
Slc24a3 T A 2: 145,448,750 (GRCm39) D431E probably benign Het
Slc34a1 C A 13: 23,996,569 (GRCm39) H25N probably damaging Het
Slc9a9 T C 9: 94,567,191 (GRCm39) F87L probably benign Het
Spata31 T A 13: 65,065,456 (GRCm39) S54T possibly damaging Het
Spata6 T C 4: 111,632,020 (GRCm39) S144P probably damaging Het
Sppl2c A G 11: 104,077,595 (GRCm39) N132D probably benign Het
Ssu2 C T 6: 112,351,793 (GRCm39) G311S probably damaging Het
Syne1 T A 10: 5,104,531 (GRCm39) Q6328L possibly damaging Het
Tie1 T C 4: 118,330,062 (GRCm39) T1054A possibly damaging Het
Tnfaip6 T G 2: 51,942,328 (GRCm39) D212E probably benign Het
Tnxb A G 17: 34,909,166 (GRCm39) T1442A probably damaging Het
Trim35 C T 14: 66,546,244 (GRCm39) T337M probably damaging Het
Vipr1 T C 9: 121,498,489 (GRCm39) V413A probably benign Het
Vmn1r19 C G 6: 57,381,578 (GRCm39) Q44E probably damaging Het
Zfp1002 T C 2: 150,097,246 (GRCm39) D61G probably benign Het
Zfp266 G T 9: 20,410,577 (GRCm39) H533Q probably damaging Het
Zfp689 T C 7: 127,043,896 (GRCm39) S245G probably damaging Het
Other mutations in Map3k6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Map3k6 APN 4 132,970,355 (GRCm39) splice site probably benign
IGL01060:Map3k6 APN 4 132,974,613 (GRCm39) splice site probably null
IGL01116:Map3k6 APN 4 132,974,439 (GRCm39) missense probably damaging 0.98
IGL01341:Map3k6 APN 4 132,975,371 (GRCm39) missense possibly damaging 0.67
IGL02383:Map3k6 APN 4 132,973,932 (GRCm39) splice site probably null
IGL03090:Map3k6 APN 4 132,970,677 (GRCm39) missense probably benign 0.05
IGL03096:Map3k6 APN 4 132,978,656 (GRCm39) nonsense probably null
IGL03149:Map3k6 APN 4 132,976,999 (GRCm39) missense probably damaging 1.00
R0110:Map3k6 UTSW 4 132,971,105 (GRCm39) missense probably damaging 1.00
R0142:Map3k6 UTSW 4 132,978,257 (GRCm39) missense probably benign
R0189:Map3k6 UTSW 4 132,974,252 (GRCm39) missense possibly damaging 0.46
R0368:Map3k6 UTSW 4 132,979,970 (GRCm39) missense probably benign 0.23
R0417:Map3k6 UTSW 4 132,975,393 (GRCm39) nonsense probably null
R0595:Map3k6 UTSW 4 132,968,574 (GRCm39) missense probably damaging 0.98
R0597:Map3k6 UTSW 4 132,972,863 (GRCm39) missense possibly damaging 0.46
R0699:Map3k6 UTSW 4 132,975,437 (GRCm39) missense probably damaging 1.00
R1099:Map3k6 UTSW 4 132,974,439 (GRCm39) missense probably damaging 1.00
R1113:Map3k6 UTSW 4 132,973,126 (GRCm39) missense probably damaging 1.00
R1308:Map3k6 UTSW 4 132,973,126 (GRCm39) missense probably damaging 1.00
R1607:Map3k6 UTSW 4 132,979,784 (GRCm39) missense probably damaging 1.00
R2217:Map3k6 UTSW 4 132,973,983 (GRCm39) missense possibly damaging 0.46
R3734:Map3k6 UTSW 4 132,975,707 (GRCm39) missense possibly damaging 0.79
R3735:Map3k6 UTSW 4 132,973,683 (GRCm39) missense probably benign 0.21
R3743:Map3k6 UTSW 4 132,972,384 (GRCm39) missense probably benign 0.26
R4244:Map3k6 UTSW 4 132,979,258 (GRCm39) missense possibly damaging 0.65
R4245:Map3k6 UTSW 4 132,979,258 (GRCm39) missense possibly damaging 0.65
R4465:Map3k6 UTSW 4 132,973,644 (GRCm39) missense possibly damaging 0.66
R4482:Map3k6 UTSW 4 132,970,710 (GRCm39) missense probably benign 0.00
R4827:Map3k6 UTSW 4 132,976,160 (GRCm39) missense possibly damaging 0.92
R5092:Map3k6 UTSW 4 132,979,054 (GRCm39) missense probably benign 0.00
R5110:Map3k6 UTSW 4 132,974,859 (GRCm39) intron probably benign
R5258:Map3k6 UTSW 4 132,974,953 (GRCm39) missense possibly damaging 0.81
R5369:Map3k6 UTSW 4 132,974,992 (GRCm39) missense probably damaging 0.99
R5642:Map3k6 UTSW 4 132,972,855 (GRCm39) missense probably damaging 0.99
R5648:Map3k6 UTSW 4 132,970,646 (GRCm39) missense probably benign 0.25
R6102:Map3k6 UTSW 4 132,974,442 (GRCm39) critical splice donor site probably null
R6144:Map3k6 UTSW 4 132,972,986 (GRCm39) missense probably damaging 1.00
R6511:Map3k6 UTSW 4 132,975,389 (GRCm39) missense probably damaging 0.98
R6522:Map3k6 UTSW 4 132,977,335 (GRCm39) missense possibly damaging 0.65
R6706:Map3k6 UTSW 4 132,978,250 (GRCm39) nonsense probably null
R6874:Map3k6 UTSW 4 132,977,967 (GRCm39) missense probably benign 0.02
R7069:Map3k6 UTSW 4 132,979,023 (GRCm39) missense probably benign 0.01
R7216:Map3k6 UTSW 4 132,974,211 (GRCm39) missense probably damaging 0.99
R7417:Map3k6 UTSW 4 132,975,707 (GRCm39) missense probably benign 0.43
R7538:Map3k6 UTSW 4 132,979,238 (GRCm39) missense probably benign
R7569:Map3k6 UTSW 4 132,977,388 (GRCm39) missense probably benign 0.04
R8003:Map3k6 UTSW 4 132,976,193 (GRCm39) missense probably benign 0.05
R8407:Map3k6 UTSW 4 132,974,904 (GRCm39) missense possibly damaging 0.95
R8817:Map3k6 UTSW 4 132,974,071 (GRCm39) missense probably benign 0.00
R8939:Map3k6 UTSW 4 132,979,954 (GRCm39) unclassified probably benign
R9285:Map3k6 UTSW 4 132,972,870 (GRCm39) missense probably damaging 1.00
R9308:Map3k6 UTSW 4 132,970,722 (GRCm39) missense probably damaging 1.00
R9400:Map3k6 UTSW 4 132,968,467 (GRCm39) missense probably damaging 1.00
R9401:Map3k6 UTSW 4 132,968,467 (GRCm39) missense probably damaging 1.00
R9573:Map3k6 UTSW 4 132,979,774 (GRCm39) missense probably damaging 0.99
R9677:Map3k6 UTSW 4 132,968,427 (GRCm39) missense probably benign 0.04
R9682:Map3k6 UTSW 4 132,975,419 (GRCm39) missense possibly damaging 0.61
R9745:Map3k6 UTSW 4 132,979,783 (GRCm39) missense probably damaging 1.00
R9751:Map3k6 UTSW 4 132,979,168 (GRCm39) critical splice acceptor site probably null
Z1088:Map3k6 UTSW 4 132,972,377 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAGCACCTCTGATCTGATCG -3'
(R):5'- GCCTTGGGAATGTCTGAGAC -3'

Sequencing Primer
(F):5'- GATCGTGGGGTTATCTATCCCATC -3'
(R):5'- AATGTCTGAGACTGTGTGGC -3'
Posted On 2018-05-21