Incidental Mutation 'R6476:Olfr294'
ID516785
Institutional Source Beutler Lab
Gene Symbol Olfr294
Ensembl Gene ENSMUSG00000062042
Gene Nameolfactory receptor 294
SynonymsGA_x6K02T2NHDJ-9504525-9505532, MOR219-5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R6476 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location86615636-86616643 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86616010 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 212 (V212I)
Ref Sequence ENSEMBL: ENSMUSP00000077662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078588]
Predicted Effect probably benign
Transcript: ENSMUST00000078588
AA Change: V212I

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000077662
Gene: ENSMUSG00000062042
AA Change: V212I

DomainStartEndE-ValueType
Pfam:7tm_4 29 309 1.2e-38 PFAM
Pfam:7tm_1 39 288 1.8e-22 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A C 19: 5,503,225 I176S probably damaging Het
a T C 2: 155,050,779 V126A probably benign Het
Adamts20 T C 15: 94,361,810 Q336R probably benign Het
Ankrd36 A G 11: 5,628,753 T6A probably benign Het
Arhgap33 A G 7: 30,524,412 S731P probably damaging Het
Arhgef10l G C 4: 140,611,382 P23R probably damaging Het
Atf7 T C 15: 102,593,712 D3G probably benign Het
Caps2 A G 10: 112,175,560 T30A possibly damaging Het
Ccdc15 A T 9: 37,342,419 I191N probably benign Het
Cep170 A T 1: 176,780,351 S180T possibly damaging Het
Chd1 G A 17: 17,380,988 probably null Het
Col6a3 A T 1: 90,781,812 N1887K unknown Het
Csgalnact1 C T 8: 68,461,109 S148N probably damaging Het
Csgalnact1 T A 8: 68,461,110 S148C probably damaging Het
D10Jhu81e T C 10: 78,167,513 N102D probably damaging Het
Dnah14 A G 1: 181,744,768 E2888G probably benign Het
Dnah7b T A 1: 46,242,204 Y2808* probably null Het
Dock10 A C 1: 80,541,242 L1254* probably null Het
Eml2 T C 7: 19,196,311 V511A probably benign Het
Eml6 A G 11: 29,791,971 probably null Het
Erbin C A 13: 103,841,247 D601Y probably damaging Het
Fam35a T C 14: 34,268,014 S312G probably benign Het
Farsa A G 8: 84,857,180 E49G probably damaging Het
Fzd7 A G 1: 59,483,995 M346V probably damaging Het
Glg1 A C 8: 111,200,174 S170A possibly damaging Het
Gm21994 T C 2: 150,255,326 D61G probably benign Het
Gm340 C T 19: 41,583,079 T237I probably benign Het
Gpx3 A T 11: 54,907,199 I54F probably damaging Het
H6pd G A 4: 149,982,727 H401Y probably damaging Het
Hspb8 A G 5: 116,422,398 S28P probably damaging Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Krt9 A T 11: 100,190,814 D296E probably damaging Het
Lnx1 A G 5: 74,607,880 V349A possibly damaging Het
Map3k6 A T 4: 133,250,086 S915C probably damaging Het
Mecom C A 3: 29,980,568 A510S possibly damaging Het
Mettl14 A G 3: 123,374,037 I224T probably damaging Het
Mme T C 3: 63,343,635 probably null Het
Nbea T A 3: 56,004,806 T1187S probably benign Het
Ndor1 T C 2: 25,248,142 T444A possibly damaging Het
Nhlrc1 A G 13: 47,014,181 L200P possibly damaging Het
Npc1 G T 18: 12,201,694 S667* probably null Het
Olfr1009 T A 2: 85,721,584 Y60N probably damaging Het
Olfr1214 T A 2: 88,987,377 D275V probably benign Het
Olfr355 T A 2: 36,927,583 H177L possibly damaging Het
Olfr557 T A 7: 102,699,103 N288K possibly damaging Het
Pds5a A C 5: 65,634,287 I773R possibly damaging Het
Pgr T A 9: 8,964,838 probably null Het
Plscr4 A T 9: 92,490,766 M314L probably benign Het
Polr2m A G 9: 71,483,470 V46A probably benign Het
Ptk2b T A 14: 66,187,474 M174L possibly damaging Het
Sec31a A T 5: 100,386,149 F521I probably benign Het
Serpinb3d T C 1: 107,083,341 N47S probably benign Het
Slc17a2 C A 13: 23,812,586 H25N probably damaging Het
Slc24a3 T A 2: 145,606,830 D431E probably benign Het
Slc9a9 T C 9: 94,685,138 F87L probably benign Het
Spata31 T A 13: 64,917,642 S54T possibly damaging Het
Spata6 T C 4: 111,774,823 S144P probably damaging Het
Sppl2c A G 11: 104,186,769 N132D probably benign Het
Ssu2 C T 6: 112,374,832 G311S probably damaging Het
Syne1 T A 10: 5,154,531 Q6328L possibly damaging Het
Tie1 T C 4: 118,472,865 T1054A possibly damaging Het
Tnfaip6 T G 2: 52,052,316 D212E probably benign Het
Tnxb A G 17: 34,690,192 T1442A probably damaging Het
Trim35 C T 14: 66,308,795 T337M probably damaging Het
Vipr1 T C 9: 121,669,423 V413A probably benign Het
Vmn1r19 C G 6: 57,404,593 Q44E probably damaging Het
Zfp266 G T 9: 20,499,281 H533Q probably damaging Het
Zfp689 T C 7: 127,444,724 S245G probably damaging Het
Other mutations in Olfr294
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Olfr294 APN 7 86615997 missense probably damaging 1.00
IGL02617:Olfr294 APN 7 86615664 missense probably benign 0.14
IGL02694:Olfr294 APN 7 86616310 missense probably benign 0.00
IGL02828:Olfr294 APN 7 86616069 missense possibly damaging 0.67
IGL03229:Olfr294 APN 7 86616078 missense probably benign 0.00
IGL03351:Olfr294 APN 7 86615677 missense possibly damaging 0.68
PIT4802001:Olfr294 UTSW 7 86616555 missense probably null 1.00
R0848:Olfr294 UTSW 7 86615640 missense probably damaging 0.96
R1448:Olfr294 UTSW 7 86616361 missense probably damaging 1.00
R1720:Olfr294 UTSW 7 86616456 missense probably damaging 1.00
R1734:Olfr294 UTSW 7 86616217 missense probably benign 0.07
R1959:Olfr294 UTSW 7 86616431 missense probably benign 0.00
R2116:Olfr294 UTSW 7 86616078 missense probably benign 0.00
R2518:Olfr294 UTSW 7 86616187 missense probably benign 0.03
R3034:Olfr294 UTSW 7 86615762 missense possibly damaging 0.50
R3110:Olfr294 UTSW 7 86615676 missense probably benign
R3112:Olfr294 UTSW 7 86615676 missense probably benign
R3690:Olfr294 UTSW 7 86616478 missense probably damaging 1.00
R4612:Olfr294 UTSW 7 86615736 missense probably benign 0.00
R6895:Olfr294 UTSW 7 86616115 missense probably damaging 1.00
R7102:Olfr294 UTSW 7 86616267 missense probably benign 0.25
R7104:Olfr294 UTSW 7 86615692 missense probably null 0.07
R7179:Olfr294 UTSW 7 86616366 missense possibly damaging 0.76
R7256:Olfr294 UTSW 7 86615665 missense probably benign 0.03
R7624:Olfr294 UTSW 7 86616561 missense possibly damaging 0.47
R8422:Olfr294 UTSW 7 86616258 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CAATTGATGCTGAACGTGAGGG -3'
(R):5'- AGTAGTCGTAACTGTATGCTGATG -3'

Sequencing Primer
(F):5'- GTGGCTTCAGATTGACAAAGC -3'
(R):5'- TCTGTTTGGAGCTTTATACACAGC -3'
Posted On2018-05-21