Incidental Mutation 'R6476:Csgalnact1'
ID 516788
Institutional Source Beutler Lab
Gene Symbol Csgalnact1
Ensembl Gene ENSMUSG00000036356
Gene Name chondroitin sulfate N-acetylgalactosaminyltransferase 1
Synonyms CSGalNAcT-1, 4732435N03Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock # R6476 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 68356781-68735146 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 68461109 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 148 (S148N)
Ref Sequence ENSEMBL: ENSMUSP00000116134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078350] [ENSMUST00000130214] [ENSMUST00000136060]
AlphaFold Q8BJQ9
Predicted Effect probably damaging
Transcript: ENSMUST00000078350
AA Change: S148N

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000077459
Gene: ENSMUSG00000036356
AA Change: S148N

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:CHGN 55 505 3.5e-85 PFAM
Pfam:Glyco_tranf_2_2 263 478 3.2e-10 PFAM
Pfam:Glyco_transf_7C 409 478 1.7e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130214
AA Change: S148N

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119817
Gene: ENSMUSG00000036356
AA Change: S148N

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:CHGN 71 505 1.1e-59 PFAM
Pfam:Glyco_tranf_2_2 263 478 3.6e-10 PFAM
Pfam:Glyco_transf_7C 405 478 3.4e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132076
Predicted Effect probably damaging
Transcript: ENSMUST00000136060
AA Change: S148N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116134
Gene: ENSMUSG00000036356
AA Change: S148N

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:CHGN 66 300 1.6e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211871
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and length, short limbs, and abnormal cartilage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A C 19: 5,503,225 I176S probably damaging Het
a T C 2: 155,050,779 V126A probably benign Het
Adamts20 T C 15: 94,361,810 Q336R probably benign Het
Ankrd36 A G 11: 5,628,753 T6A probably benign Het
Arhgap33 A G 7: 30,524,412 S731P probably damaging Het
Arhgef10l G C 4: 140,611,382 P23R probably damaging Het
Atf7 T C 15: 102,593,712 D3G probably benign Het
Caps2 A G 10: 112,175,560 T30A possibly damaging Het
Ccdc15 A T 9: 37,342,419 I191N probably benign Het
Cep170 A T 1: 176,780,351 S180T possibly damaging Het
Chd1 G A 17: 17,380,988 probably null Het
Col6a3 A T 1: 90,781,812 N1887K unknown Het
D10Jhu81e T C 10: 78,167,513 N102D probably damaging Het
Dnah14 A G 1: 181,744,768 E2888G probably benign Het
Dnah7b T A 1: 46,242,204 Y2808* probably null Het
Dock10 A C 1: 80,541,242 L1254* probably null Het
Eml2 T C 7: 19,196,311 V511A probably benign Het
Eml6 A G 11: 29,791,971 probably null Het
Erbin C A 13: 103,841,247 D601Y probably damaging Het
Fam35a T C 14: 34,268,014 S312G probably benign Het
Farsa A G 8: 84,857,180 E49G probably damaging Het
Fzd7 A G 1: 59,483,995 M346V probably damaging Het
Glg1 A C 8: 111,200,174 S170A possibly damaging Het
Gm21994 T C 2: 150,255,326 D61G probably benign Het
Gm340 C T 19: 41,583,079 T237I probably benign Het
Gpx3 A T 11: 54,907,199 I54F probably damaging Het
H6pd G A 4: 149,982,727 H401Y probably damaging Het
Hspb8 A G 5: 116,422,398 S28P probably damaging Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Krt9 A T 11: 100,190,814 D296E probably damaging Het
Lnx1 A G 5: 74,607,880 V349A possibly damaging Het
Map3k6 A T 4: 133,250,086 S915C probably damaging Het
Mecom C A 3: 29,980,568 A510S possibly damaging Het
Mettl14 A G 3: 123,374,037 I224T probably damaging Het
Mme T C 3: 63,343,635 probably null Het
Nbea T A 3: 56,004,806 T1187S probably benign Het
Ndor1 T C 2: 25,248,142 T444A possibly damaging Het
Nhlrc1 A G 13: 47,014,181 L200P possibly damaging Het
Npc1 G T 18: 12,201,694 S667* probably null Het
Olfr1009 T A 2: 85,721,584 Y60N probably damaging Het
Olfr1214 T A 2: 88,987,377 D275V probably benign Het
Olfr294 C T 7: 86,616,010 V212I probably benign Het
Olfr355 T A 2: 36,927,583 H177L possibly damaging Het
Olfr557 T A 7: 102,699,103 N288K possibly damaging Het
Pds5a A C 5: 65,634,287 I773R possibly damaging Het
Pgr T A 9: 8,964,838 probably null Het
Plscr4 A T 9: 92,490,766 M314L probably benign Het
Polr2m A G 9: 71,483,470 V46A probably benign Het
Ptk2b T A 14: 66,187,474 M174L possibly damaging Het
Sec31a A T 5: 100,386,149 F521I probably benign Het
Serpinb3d T C 1: 107,083,341 N47S probably benign Het
Slc17a2 C A 13: 23,812,586 H25N probably damaging Het
Slc24a3 T A 2: 145,606,830 D431E probably benign Het
Slc9a9 T C 9: 94,685,138 F87L probably benign Het
Spata31 T A 13: 64,917,642 S54T possibly damaging Het
Spata6 T C 4: 111,774,823 S144P probably damaging Het
Sppl2c A G 11: 104,186,769 N132D probably benign Het
Ssu2 C T 6: 112,374,832 G311S probably damaging Het
Syne1 T A 10: 5,154,531 Q6328L possibly damaging Het
Tie1 T C 4: 118,472,865 T1054A possibly damaging Het
Tnfaip6 T G 2: 52,052,316 D212E probably benign Het
Tnxb A G 17: 34,690,192 T1442A probably damaging Het
Trim35 C T 14: 66,308,795 T337M probably damaging Het
Vipr1 T C 9: 121,669,423 V413A probably benign Het
Vmn1r19 C G 6: 57,404,593 Q44E probably damaging Het
Zfp266 G T 9: 20,499,281 H533Q probably damaging Het
Zfp689 T C 7: 127,444,724 S245G probably damaging Het
Other mutations in Csgalnact1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02015:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02025:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02037:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02059:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02074:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02079:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02080:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02094:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02127:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02128:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02157:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02158:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02197:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02201:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02206:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02207:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02214:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02215:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02229:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02243:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02247:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02248:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02250:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02389:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02394:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02397:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02398:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02400:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02404:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02405:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02406:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02420:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02425:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02428:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02436:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02437:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02438:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02468:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02470:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02472:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02473:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02474:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02475:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02510:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02529:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02530:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02531:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02533:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02543:Csgalnact1 APN 8 68461068 missense probably damaging 1.00
IGL02620:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02625:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02671:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02674:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02683:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02685:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02686:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02697:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02698:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02741:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02985:Csgalnact1 APN 8 68461043 missense probably benign 0.02
R0173:Csgalnact1 UTSW 8 68461029 missense probably damaging 1.00
R1594:Csgalnact1 UTSW 8 68358632 missense probably damaging 1.00
R1655:Csgalnact1 UTSW 8 68373689 missense possibly damaging 0.89
R1873:Csgalnact1 UTSW 8 68401384 missense probably benign 0.02
R1955:Csgalnact1 UTSW 8 68372667 missense probably benign
R2421:Csgalnact1 UTSW 8 68461508 missense probably benign 0.42
R3195:Csgalnact1 UTSW 8 68461085 frame shift probably null
R3196:Csgalnact1 UTSW 8 68461085 frame shift probably null
R3951:Csgalnact1 UTSW 8 68461262 missense probably benign
R4304:Csgalnact1 UTSW 8 68372642 missense possibly damaging 0.94
R4989:Csgalnact1 UTSW 8 68460971 missense probably benign 0.01
R5133:Csgalnact1 UTSW 8 68460971 missense probably benign 0.01
R5134:Csgalnact1 UTSW 8 68460971 missense probably benign 0.01
R5503:Csgalnact1 UTSW 8 68461473 missense probably damaging 0.98
R5812:Csgalnact1 UTSW 8 68401384 missense probably benign 0.02
R6143:Csgalnact1 UTSW 8 68373550 missense probably damaging 1.00
R6387:Csgalnact1 UTSW 8 68358713 missense probably damaging 1.00
R6476:Csgalnact1 UTSW 8 68461110 missense probably damaging 1.00
R7023:Csgalnact1 UTSW 8 68358429 missense probably benign
R8318:Csgalnact1 UTSW 8 68461133 missense probably damaging 1.00
R8446:Csgalnact1 UTSW 8 68461091 missense probably damaging 0.99
R8519:Csgalnact1 UTSW 8 68401453 missense possibly damaging 0.65
R8674:Csgalnact1 UTSW 8 68373616 missense possibly damaging 0.91
R8782:Csgalnact1 UTSW 8 68358655 missense probably damaging 1.00
R9210:Csgalnact1 UTSW 8 68461589 start gained probably benign
Z1088:Csgalnact1 UTSW 8 68401330 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAACCTTCTATGAAGTCTGC -3'
(R):5'- TCAGCTAAAGGATGAACTGCAG -3'

Sequencing Primer
(F):5'- AACCTTCTATGAAGTCTGCAGCTG -3'
(R):5'- AGTGAGCAGTTCCGCAGTG -3'
Posted On 2018-05-21