Mutagenetix > Incidental Mutations

Incidental Mutation 'R6476:Csgalnact1'

516789

Institutional Source

Beutler Lab

Gene Symbol

Csgalnact1

Ensembl Gene

ENSMUSG00000036356

Gene Name

chondroitin sulfate N-acetylgalactosaminyltransferase 1

Synonyms

CSGalNAcT-1, 4732435N03Rik

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.082) question?

Stock #

R6476 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

68356781-68735146 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 68461110 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Cysteine at position 148 (S148C)

Ref Sequence

ENSEMBL: ENSMUSP00000116134 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078350] [ENSMUST00000130214] [ENSMUST00000136060]

AlphaFold

Q8BJQ9

Predicted Effect

probably damaging
Transcript: ENSMUST00000078350
AA Change: S148C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077459
Gene: ENSMUSG00000036356
AA Change: S148C

Domain	Start	End	E-Value	Type
transmembrane domain	9	31	N/A	INTRINSIC
Pfam:CHGN	55	505	3.5e-85	PFAM
Pfam:Glyco_tranf_2_2	263	478	3.2e-10	PFAM
Pfam:Glyco_transf_7C	409	478	1.7e-12	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000130214
AA Change: S148C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000119817
Gene: ENSMUSG00000036356
AA Change: S148C

Domain	Start	End	E-Value	Type
transmembrane domain	9	31	N/A	INTRINSIC
Pfam:CHGN	71	505	1.1e-59	PFAM
Pfam:Glyco_tranf_2_2	263	478	3.6e-10	PFAM
Pfam:Glyco_transf_7C	405	478	3.4e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132076

Predicted Effect

probably damaging
Transcript: ENSMUST00000136060
AA Change: S148C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000116134
Gene: ENSMUSG00000036356
AA Change: S148C

Domain	Start	End	E-Value	Type
transmembrane domain	9	31	N/A	INTRINSIC
Pfam:CHGN	66	300	1.6e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143586

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211871

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and length, short limbs, and abnormal cartilage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020D05Rik	A	C	19: 5,503,225	I176S	probably damaging	Het
a	T	C	2: 155,050,779	V126A	probably benign	Het
Adamts20	T	C	15: 94,361,810	Q336R	probably benign	Het
Ankrd36	A	G	11: 5,628,753	T6A	probably benign	Het
Arhgap33	A	G	7: 30,524,412	S731P	probably damaging	Het
Arhgef10l	G	C	4: 140,611,382	P23R	probably damaging	Het
Atf7	T	C	15: 102,593,712	D3G	probably benign	Het
Caps2	A	G	10: 112,175,560	T30A	possibly damaging	Het
Ccdc15	A	T	9: 37,342,419	I191N	probably benign	Het
Cep170	A	T	1: 176,780,351	S180T	possibly damaging	Het
Chd1	G	A	17: 17,380,988		probably null	Het
Col6a3	A	T	1: 90,781,812	N1887K	unknown	Het
D10Jhu81e	T	C	10: 78,167,513	N102D	probably damaging	Het
Dnah14	A	G	1: 181,744,768	E2888G	probably benign	Het
Dnah7b	T	A	1: 46,242,204	Y2808*	probably null	Het
Dock10	A	C	1: 80,541,242	L1254*	probably null	Het
Eml2	T	C	7: 19,196,311	V511A	probably benign	Het
Eml6	A	G	11: 29,791,971		probably null	Het
Erbin	C	A	13: 103,841,247	D601Y	probably damaging	Het
Fam35a	T	C	14: 34,268,014	S312G	probably benign	Het
Farsa	A	G	8: 84,857,180	E49G	probably damaging	Het
Fzd7	A	G	1: 59,483,995	M346V	probably damaging	Het
Glg1	A	C	8: 111,200,174	S170A	possibly damaging	Het
Gm21994	T	C	2: 150,255,326	D61G	probably benign	Het
Gm340	C	T	19: 41,583,079	T237I	probably benign	Het
Gpx3	A	T	11: 54,907,199	I54F	probably damaging	Het
H6pd	G	A	4: 149,982,727	H401Y	probably damaging	Het
Hspb8	A	G	5: 116,422,398	S28P	probably damaging	Het
Iqub	T	A	6: 24,449,745	N707I	probably damaging	Het
Krt9	A	T	11: 100,190,814	D296E	probably damaging	Het
Lnx1	A	G	5: 74,607,880	V349A	possibly damaging	Het
Map3k6	A	T	4: 133,250,086	S915C	probably damaging	Het
Mecom	C	A	3: 29,980,568	A510S	possibly damaging	Het
Mettl14	A	G	3: 123,374,037	I224T	probably damaging	Het
Mme	T	C	3: 63,343,635		probably null	Het
Nbea	T	A	3: 56,004,806	T1187S	probably benign	Het
Ndor1	T	C	2: 25,248,142	T444A	possibly damaging	Het
Nhlrc1	A	G	13: 47,014,181	L200P	possibly damaging	Het
Npc1	G	T	18: 12,201,694	S667*	probably null	Het
Olfr1009	T	A	2: 85,721,584	Y60N	probably damaging	Het
Olfr1214	T	A	2: 88,987,377	D275V	probably benign	Het
Olfr294	C	T	7: 86,616,010	V212I	probably benign	Het
Olfr355	T	A	2: 36,927,583	H177L	possibly damaging	Het
Olfr557	T	A	7: 102,699,103	N288K	possibly damaging	Het
Pds5a	A	C	5: 65,634,287	I773R	possibly damaging	Het
Pgr	T	A	9: 8,964,838		probably null	Het
Plscr4	A	T	9: 92,490,766	M314L	probably benign	Het
Polr2m	A	G	9: 71,483,470	V46A	probably benign	Het
Ptk2b	T	A	14: 66,187,474	M174L	possibly damaging	Het
Sec31a	A	T	5: 100,386,149	F521I	probably benign	Het
Serpinb3d	T	C	1: 107,083,341	N47S	probably benign	Het
Slc17a2	C	A	13: 23,812,586	H25N	probably damaging	Het
Slc24a3	T	A	2: 145,606,830	D431E	probably benign	Het
Slc9a9	T	C	9: 94,685,138	F87L	probably benign	Het
Spata31	T	A	13: 64,917,642	S54T	possibly damaging	Het
Spata6	T	C	4: 111,774,823	S144P	probably damaging	Het
Sppl2c	A	G	11: 104,186,769	N132D	probably benign	Het
Ssu2	C	T	6: 112,374,832	G311S	probably damaging	Het
Syne1	T	A	10: 5,154,531	Q6328L	possibly damaging	Het
Tie1	T	C	4: 118,472,865	T1054A	possibly damaging	Het
Tnfaip6	T	G	2: 52,052,316	D212E	probably benign	Het
Tnxb	A	G	17: 34,690,192	T1442A	probably damaging	Het
Trim35	C	T	14: 66,308,795	T337M	probably damaging	Het
Vipr1	T	C	9: 121,669,423	V413A	probably benign	Het
Vmn1r19	C	G	6: 57,404,593	Q44E	probably damaging	Het
Zfp266	G	T	9: 20,499,281	H533Q	probably damaging	Het
Zfp689	T	C	7: 127,444,724	S245G	probably damaging	Het

Other mutations in Csgalnact1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02015:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02025:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02037:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02059:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02074:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02079:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02080:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02094:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02127:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02128:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02157:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02158:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02197:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02201:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02206:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02207:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02214:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02215:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02229:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02243:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02247:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02248:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02250:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02389:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02394:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02397:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02398:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02400:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02404:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02405:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02406:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02420:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02425:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02428:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02436:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02437:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02438:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02468:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02470:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02472:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02473:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02474:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02475:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02510:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02529:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02530:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02531:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02533:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02543:Csgalnact1	APN	8	68461068	missense	probably damaging	1.00
IGL02620:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02625:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02671:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02674:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02683:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02685:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02686:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02697:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02698:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02741:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02985:Csgalnact1	APN	8	68461043	missense	probably benign	0.02
R0173:Csgalnact1	UTSW	8	68461029	missense	probably damaging	1.00
R1594:Csgalnact1	UTSW	8	68358632	missense	probably damaging	1.00
R1655:Csgalnact1	UTSW	8	68373689	missense	possibly damaging	0.89
R1873:Csgalnact1	UTSW	8	68401384	missense	probably benign	0.02
R1955:Csgalnact1	UTSW	8	68372667	missense	probably benign
R2421:Csgalnact1	UTSW	8	68461508	missense	probably benign	0.42
R3195:Csgalnact1	UTSW	8	68461085	frame shift	probably null
R3196:Csgalnact1	UTSW	8	68461085	frame shift	probably null
R3951:Csgalnact1	UTSW	8	68461262	missense	probably benign
R4304:Csgalnact1	UTSW	8	68372642	missense	possibly damaging	0.94
R4989:Csgalnact1	UTSW	8	68460971	missense	probably benign	0.01
R5133:Csgalnact1	UTSW	8	68460971	missense	probably benign	0.01
R5134:Csgalnact1	UTSW	8	68460971	missense	probably benign	0.01
R5503:Csgalnact1	UTSW	8	68461473	missense	probably damaging	0.98
R5812:Csgalnact1	UTSW	8	68401384	missense	probably benign	0.02
R6143:Csgalnact1	UTSW	8	68373550	missense	probably damaging	1.00
R6387:Csgalnact1	UTSW	8	68358713	missense	probably damaging	1.00
R6476:Csgalnact1	UTSW	8	68461109	missense	probably damaging	1.00
R7023:Csgalnact1	UTSW	8	68358429	missense	probably benign
R8318:Csgalnact1	UTSW	8	68461133	missense	probably damaging	1.00
R8446:Csgalnact1	UTSW	8	68461091	missense	probably damaging	0.99
R8519:Csgalnact1	UTSW	8	68401453	missense	possibly damaging	0.65
R8674:Csgalnact1	UTSW	8	68373616	missense	possibly damaging	0.91
R8782:Csgalnact1	UTSW	8	68358655	missense	probably damaging	1.00
R9210:Csgalnact1	UTSW	8	68461589	start gained	probably benign
Z1088:Csgalnact1	UTSW	8	68401330	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATGCCAACCTTCTATGAAGTCTG -3'
(R):5'- CTAAAGGATGAACTGCAGGCAC -3'

Sequencing Primer
(F):5'- AACCTTCTATGAAGTCTGCAGCTG -3'
(R):5'- ACGCAGTGAGCAGTTCC -3'

Posted On

2018-05-21