Incidental Mutation 'R6476:Glg1'
ID 516791
Institutional Source Beutler Lab
Gene Symbol Glg1
Ensembl Gene ENSMUSG00000003316
Gene Name golgi apparatus protein 1
Synonyms Selel, CFR, MG-160, CFR-1, ESL-1, MG160
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.321) question?
Stock # R6476 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 111154421-111259216 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 111200174 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 170 (S170A)
Ref Sequence ENSEMBL: ENSMUSP00000131659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003404] [ENSMUST00000164283] [ENSMUST00000169020]
AlphaFold Q61543
Predicted Effect probably benign
Transcript: ENSMUST00000003404
AA Change: S159A

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000003404
Gene: ENSMUSG00000003316
AA Change: S159A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cys_rich_FGFR 141 197 3.1e-13 PFAM
Pfam:Cys_rich_FGFR 199 263 1.3e-16 PFAM
Pfam:Cys_rich_FGFR 274 331 1.5e-16 PFAM
Pfam:Cys_rich_FGFR 334 398 1.6e-16 PFAM
Pfam:Cys_rich_FGFR 402 458 1.8e-15 PFAM
Pfam:Cys_rich_FGFR 463 522 2.3e-16 PFAM
Pfam:Cys_rich_FGFR 525 589 5.8e-19 PFAM
Pfam:Cys_rich_FGFR 597 653 6e-17 PFAM
Pfam:Cys_rich_FGFR 654 714 2e-14 PFAM
Pfam:Cys_rich_FGFR 717 773 4.7e-14 PFAM
Pfam:Cys_rich_FGFR 784 841 1e-18 PFAM
Pfam:Cys_rich_FGFR 842 897 4.2e-17 PFAM
Pfam:Cys_rich_FGFR 900 964 2.1e-21 PFAM
Pfam:Cys_rich_FGFR 967 1027 3.5e-16 PFAM
Pfam:Cys_rich_FGFR 1029 1086 8e-17 PFAM
transmembrane domain 1131 1153 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164283
AA Change: S170A

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131659
Gene: ENSMUSG00000003316
AA Change: S170A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cys_rich_FGFR 149 208 2.3e-16 PFAM
Pfam:Cys_rich_FGFR 210 267 1.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169020
AA Change: S170A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000131355
Gene: ENSMUSG00000003316
AA Change: S170A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cys_rich_FGFR 149 208 2.9e-15 PFAM
Pfam:Cys_rich_FGFR 210 274 1.3e-16 PFAM
Pfam:Cys_rich_FGFR 285 342 1.4e-16 PFAM
Pfam:Cys_rich_FGFR 345 409 7.2e-16 PFAM
Pfam:Cys_rich_FGFR 413 469 8.4e-16 PFAM
Pfam:Cys_rich_FGFR 474 533 6.4e-17 PFAM
Pfam:Cys_rich_FGFR 536 600 2.7e-16 PFAM
Pfam:Cys_rich_FGFR 608 664 2.6e-17 PFAM
Pfam:Cys_rich_FGFR 665 725 1.2e-13 PFAM
Pfam:Cys_rich_FGFR 728 784 2.6e-11 PFAM
Pfam:Cys_rich_FGFR 795 852 1.4e-18 PFAM
Pfam:Cys_rich_FGFR 853 908 1.1e-15 PFAM
Pfam:Cys_rich_FGFR 911 975 1e-19 PFAM
Pfam:Cys_rich_FGFR 978 1038 1.3e-15 PFAM
Pfam:Cys_rich_FGFR 1040 1097 6e-17 PFAM
transmembrane domain 1142 1164 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Nullizygous mice show smaller size, narrow rib cages, short and thin bony elements, and reduced chondrocyte proliferation and growth plates. Homozygotes for a gene trap allele show postnatal death, small size, distorted tails and cleft palate. Homozygotes for another gene trap allele die by E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A C 19: 5,503,225 I176S probably damaging Het
a T C 2: 155,050,779 V126A probably benign Het
Adamts20 T C 15: 94,361,810 Q336R probably benign Het
Ankrd36 A G 11: 5,628,753 T6A probably benign Het
Arhgap33 A G 7: 30,524,412 S731P probably damaging Het
Arhgef10l G C 4: 140,611,382 P23R probably damaging Het
Atf7 T C 15: 102,593,712 D3G probably benign Het
Caps2 A G 10: 112,175,560 T30A possibly damaging Het
Ccdc15 A T 9: 37,342,419 I191N probably benign Het
Cep170 A T 1: 176,780,351 S180T possibly damaging Het
Chd1 G A 17: 17,380,988 probably null Het
Col6a3 A T 1: 90,781,812 N1887K unknown Het
Csgalnact1 C T 8: 68,461,109 S148N probably damaging Het
Csgalnact1 T A 8: 68,461,110 S148C probably damaging Het
D10Jhu81e T C 10: 78,167,513 N102D probably damaging Het
Dnah14 A G 1: 181,744,768 E2888G probably benign Het
Dnah7b T A 1: 46,242,204 Y2808* probably null Het
Dock10 A C 1: 80,541,242 L1254* probably null Het
Eml2 T C 7: 19,196,311 V511A probably benign Het
Eml6 A G 11: 29,791,971 probably null Het
Erbin C A 13: 103,841,247 D601Y probably damaging Het
Fam35a T C 14: 34,268,014 S312G probably benign Het
Farsa A G 8: 84,857,180 E49G probably damaging Het
Fzd7 A G 1: 59,483,995 M346V probably damaging Het
Gm21994 T C 2: 150,255,326 D61G probably benign Het
Gm340 C T 19: 41,583,079 T237I probably benign Het
Gpx3 A T 11: 54,907,199 I54F probably damaging Het
H6pd G A 4: 149,982,727 H401Y probably damaging Het
Hspb8 A G 5: 116,422,398 S28P probably damaging Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Krt9 A T 11: 100,190,814 D296E probably damaging Het
Lnx1 A G 5: 74,607,880 V349A possibly damaging Het
Map3k6 A T 4: 133,250,086 S915C probably damaging Het
Mecom C A 3: 29,980,568 A510S possibly damaging Het
Mettl14 A G 3: 123,374,037 I224T probably damaging Het
Mme T C 3: 63,343,635 probably null Het
Nbea T A 3: 56,004,806 T1187S probably benign Het
Ndor1 T C 2: 25,248,142 T444A possibly damaging Het
Nhlrc1 A G 13: 47,014,181 L200P possibly damaging Het
Npc1 G T 18: 12,201,694 S667* probably null Het
Olfr1009 T A 2: 85,721,584 Y60N probably damaging Het
Olfr1214 T A 2: 88,987,377 D275V probably benign Het
Olfr294 C T 7: 86,616,010 V212I probably benign Het
Olfr355 T A 2: 36,927,583 H177L possibly damaging Het
Olfr557 T A 7: 102,699,103 N288K possibly damaging Het
Pds5a A C 5: 65,634,287 I773R possibly damaging Het
Pgr T A 9: 8,964,838 probably null Het
Plscr4 A T 9: 92,490,766 M314L probably benign Het
Polr2m A G 9: 71,483,470 V46A probably benign Het
Ptk2b T A 14: 66,187,474 M174L possibly damaging Het
Sec31a A T 5: 100,386,149 F521I probably benign Het
Serpinb3d T C 1: 107,083,341 N47S probably benign Het
Slc17a2 C A 13: 23,812,586 H25N probably damaging Het
Slc24a3 T A 2: 145,606,830 D431E probably benign Het
Slc9a9 T C 9: 94,685,138 F87L probably benign Het
Spata31 T A 13: 64,917,642 S54T possibly damaging Het
Spata6 T C 4: 111,774,823 S144P probably damaging Het
Sppl2c A G 11: 104,186,769 N132D probably benign Het
Ssu2 C T 6: 112,374,832 G311S probably damaging Het
Syne1 T A 10: 5,154,531 Q6328L possibly damaging Het
Tie1 T C 4: 118,472,865 T1054A possibly damaging Het
Tnfaip6 T G 2: 52,052,316 D212E probably benign Het
Tnxb A G 17: 34,690,192 T1442A probably damaging Het
Trim35 C T 14: 66,308,795 T337M probably damaging Het
Vipr1 T C 9: 121,669,423 V413A probably benign Het
Vmn1r19 C G 6: 57,404,593 Q44E probably damaging Het
Zfp266 G T 9: 20,499,281 H533Q probably damaging Het
Zfp689 T C 7: 127,444,724 S245G probably damaging Het
Other mutations in Glg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Glg1 APN 8 111159849 missense probably damaging 1.00
IGL01326:Glg1 APN 8 111182573 missense probably damaging 0.96
IGL01558:Glg1 APN 8 111187730 missense probably benign 0.00
IGL01798:Glg1 APN 8 111192700 missense possibly damaging 0.58
IGL02651:Glg1 APN 8 111160727 missense possibly damaging 0.76
IGL03124:Glg1 APN 8 111200171 missense probably damaging 1.00
IGL03374:Glg1 APN 8 111162780 missense probably damaging 1.00
IGL03404:Glg1 APN 8 111159902 missense probably damaging 1.00
diabolical UTSW 8 111168743 missense probably damaging 1.00
BB007:Glg1 UTSW 8 111160735 missense possibly damaging 0.46
BB017:Glg1 UTSW 8 111160735 missense possibly damaging 0.46
PIT4362001:Glg1 UTSW 8 111258799 missense possibly damaging 0.80
R0047:Glg1 UTSW 8 111165582 missense probably damaging 1.00
R0047:Glg1 UTSW 8 111165582 missense probably damaging 1.00
R0255:Glg1 UTSW 8 111159858 missense possibly damaging 0.82
R0432:Glg1 UTSW 8 111182569 missense probably damaging 1.00
R0458:Glg1 UTSW 8 111160606 splice site probably benign
R0635:Glg1 UTSW 8 111163764 splice site probably benign
R0765:Glg1 UTSW 8 111159797 critical splice donor site probably null
R1104:Glg1 UTSW 8 111197603 missense probably benign 0.01
R1495:Glg1 UTSW 8 111197675 missense probably damaging 1.00
R1747:Glg1 UTSW 8 111197673 missense probably damaging 1.00
R1899:Glg1 UTSW 8 111165674 missense probably benign 0.23
R1950:Glg1 UTSW 8 111165639 missense possibly damaging 0.79
R2074:Glg1 UTSW 8 111168671 missense probably damaging 1.00
R2112:Glg1 UTSW 8 111192546 missense probably damaging 1.00
R2275:Glg1 UTSW 8 111168721 nonsense probably null
R2342:Glg1 UTSW 8 111187807 nonsense probably null
R4633:Glg1 UTSW 8 111177644 critical splice donor site probably null
R4716:Glg1 UTSW 8 111160775 nonsense probably null
R4732:Glg1 UTSW 8 111187755 missense probably damaging 1.00
R4733:Glg1 UTSW 8 111187755 missense probably damaging 1.00
R5594:Glg1 UTSW 8 111187881 missense probably damaging 1.00
R5722:Glg1 UTSW 8 111169562 missense possibly damaging 0.67
R5951:Glg1 UTSW 8 111165691 missense possibly damaging 0.64
R5958:Glg1 UTSW 8 111259104 missense probably benign 0.01
R6090:Glg1 UTSW 8 111181035 missense probably damaging 1.00
R6480:Glg1 UTSW 8 111197706 missense possibly damaging 0.89
R6819:Glg1 UTSW 8 111187881 missense probably damaging 1.00
R7116:Glg1 UTSW 8 111178957 missense probably benign 0.22
R7293:Glg1 UTSW 8 111168743 missense probably damaging 1.00
R7431:Glg1 UTSW 8 111160754 missense unknown
R7479:Glg1 UTSW 8 111197735 missense possibly damaging 0.91
R7509:Glg1 UTSW 8 111259043 missense probably benign 0.04
R7547:Glg1 UTSW 8 111187761 missense possibly damaging 0.89
R7678:Glg1 UTSW 8 111178865 missense probably benign 0.19
R7930:Glg1 UTSW 8 111160735 missense possibly damaging 0.46
R8182:Glg1 UTSW 8 111171297 missense possibly damaging 0.88
R8383:Glg1 UTSW 8 111169562 missense possibly damaging 0.67
R8787:Glg1 UTSW 8 111161482 missense probably damaging 0.99
R8905:Glg1 UTSW 8 111158036 missense probably damaging 0.99
R8954:Glg1 UTSW 8 111187895 missense probably damaging 1.00
R8958:Glg1 UTSW 8 111172484 nonsense probably null
R9023:Glg1 UTSW 8 111177748 missense probably damaging 0.99
R9113:Glg1 UTSW 8 111160820 intron probably benign
R9359:Glg1 UTSW 8 111187793 missense probably benign 0.08
R9403:Glg1 UTSW 8 111187793 missense probably benign 0.08
R9553:Glg1 UTSW 8 111200138 missense probably benign 0.04
R9622:Glg1 UTSW 8 111172501 missense probably damaging 1.00
R9714:Glg1 UTSW 8 111197669 missense probably damaging 1.00
X0027:Glg1 UTSW 8 111169600 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACCCTACTGTGTTGGTGG -3'
(R):5'- GCTACTGGAAATGTCAATGTGC -3'

Sequencing Primer
(F):5'- AGTTACACATCCCTGCTGAATC -3'
(R):5'- GGAAATGTCAATGTGCTTTATGTGAC -3'
Posted On 2018-05-21