Incidental Mutation 'R6476:Zfp266'
ID516792
Institutional Source Beutler Lab
Gene Symbol Zfp266
Ensembl Gene ENSMUSG00000060510
Gene Namezinc finger protein 266
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6476 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location20495068-20521417 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 20499281 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 533 (H533Q)
Ref Sequence ENSEMBL: ENSMUSP00000134217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068296] [ENSMUST00000174462] [ENSMUST00000215908]
Predicted Effect probably damaging
Transcript: ENSMUST00000068296
AA Change: H533Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066012
Gene: ENSMUSG00000060510
AA Change: H533Q

DomainStartEndE-ValueType
KRAB 41 101 1.4e-27 SMART
internal_repeat_1 138 318 2.7e-16 PROSPERO
ZnF_C2H2 343 365 7.78e-3 SMART
ZnF_C2H2 371 393 1.98e-4 SMART
ZnF_C2H2 399 421 2.27e-4 SMART
ZnF_C2H2 427 449 2.47e-5 SMART
ZnF_C2H2 455 477 2.99e-4 SMART
ZnF_C2H2 483 505 1.47e-3 SMART
ZnF_C2H2 511 533 5.81e-2 SMART
ZnF_C2H2 539 561 2.79e-4 SMART
ZnF_C2H2 567 589 2.09e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174462
AA Change: H533Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134217
Gene: ENSMUSG00000060510
AA Change: H533Q

DomainStartEndE-ValueType
KRAB 41 101 1.4e-27 SMART
internal_repeat_1 138 318 2.7e-16 PROSPERO
ZnF_C2H2 343 365 7.78e-3 SMART
ZnF_C2H2 371 393 1.98e-4 SMART
ZnF_C2H2 399 421 2.27e-4 SMART
ZnF_C2H2 427 449 2.47e-5 SMART
ZnF_C2H2 455 477 2.99e-4 SMART
ZnF_C2H2 483 505 1.47e-3 SMART
ZnF_C2H2 511 533 5.81e-2 SMART
ZnF_C2H2 539 561 2.79e-4 SMART
ZnF_C2H2 567 589 2.09e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180846
Predicted Effect probably benign
Transcript: ENSMUST00000215908
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing many tandem zinc-finger motifs. Zinc fingers are protein or nucleic acid-binding domains, and may be involved in a variety of functions, including regulation of transcription. This gene is located in a cluster of similar genes encoding zinc finger proteins on chromosome 19. Alternative splicing results in multiple transcript variants for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A C 19: 5,503,225 I176S probably damaging Het
a T C 2: 155,050,779 V126A probably benign Het
Adamts20 T C 15: 94,361,810 Q336R probably benign Het
Ankrd36 A G 11: 5,628,753 T6A probably benign Het
Arhgap33 A G 7: 30,524,412 S731P probably damaging Het
Arhgef10l G C 4: 140,611,382 P23R probably damaging Het
Atf7 T C 15: 102,593,712 D3G probably benign Het
Caps2 A G 10: 112,175,560 T30A possibly damaging Het
Ccdc15 A T 9: 37,342,419 I191N probably benign Het
Cep170 A T 1: 176,780,351 S180T possibly damaging Het
Chd1 G A 17: 17,380,988 probably null Het
Col6a3 A T 1: 90,781,812 N1887K unknown Het
Csgalnact1 C T 8: 68,461,109 S148N probably damaging Het
Csgalnact1 T A 8: 68,461,110 S148C probably damaging Het
D10Jhu81e T C 10: 78,167,513 N102D probably damaging Het
Dnah14 A G 1: 181,744,768 E2888G probably benign Het
Dnah7b T A 1: 46,242,204 Y2808* probably null Het
Dock10 A C 1: 80,541,242 L1254* probably null Het
Eml2 T C 7: 19,196,311 V511A probably benign Het
Eml6 A G 11: 29,791,971 probably null Het
Erbin C A 13: 103,841,247 D601Y probably damaging Het
Fam35a T C 14: 34,268,014 S312G probably benign Het
Farsa A G 8: 84,857,180 E49G probably damaging Het
Fzd7 A G 1: 59,483,995 M346V probably damaging Het
Glg1 A C 8: 111,200,174 S170A possibly damaging Het
Gm21994 T C 2: 150,255,326 D61G probably benign Het
Gm340 C T 19: 41,583,079 T237I probably benign Het
Gpx3 A T 11: 54,907,199 I54F probably damaging Het
H6pd G A 4: 149,982,727 H401Y probably damaging Het
Hspb8 A G 5: 116,422,398 S28P probably damaging Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Krt9 A T 11: 100,190,814 D296E probably damaging Het
Lnx1 A G 5: 74,607,880 V349A possibly damaging Het
Map3k6 A T 4: 133,250,086 S915C probably damaging Het
Mecom C A 3: 29,980,568 A510S possibly damaging Het
Mettl14 A G 3: 123,374,037 I224T probably damaging Het
Mme T C 3: 63,343,635 probably null Het
Nbea T A 3: 56,004,806 T1187S probably benign Het
Ndor1 T C 2: 25,248,142 T444A possibly damaging Het
Nhlrc1 A G 13: 47,014,181 L200P possibly damaging Het
Npc1 G T 18: 12,201,694 S667* probably null Het
Olfr1009 T A 2: 85,721,584 Y60N probably damaging Het
Olfr1214 T A 2: 88,987,377 D275V probably benign Het
Olfr294 C T 7: 86,616,010 V212I probably benign Het
Olfr355 T A 2: 36,927,583 H177L possibly damaging Het
Olfr557 T A 7: 102,699,103 N288K possibly damaging Het
Pds5a A C 5: 65,634,287 I773R possibly damaging Het
Pgr T A 9: 8,964,838 probably null Het
Plscr4 A T 9: 92,490,766 M314L probably benign Het
Polr2m A G 9: 71,483,470 V46A probably benign Het
Ptk2b T A 14: 66,187,474 M174L possibly damaging Het
Sec31a A T 5: 100,386,149 F521I probably benign Het
Serpinb3d T C 1: 107,083,341 N47S probably benign Het
Slc17a2 C A 13: 23,812,586 H25N probably damaging Het
Slc24a3 T A 2: 145,606,830 D431E probably benign Het
Slc9a9 T C 9: 94,685,138 F87L probably benign Het
Spata31 T A 13: 64,917,642 S54T possibly damaging Het
Spata6 T C 4: 111,774,823 S144P probably damaging Het
Sppl2c A G 11: 104,186,769 N132D probably benign Het
Ssu2 C T 6: 112,374,832 G311S probably damaging Het
Syne1 T A 10: 5,154,531 Q6328L possibly damaging Het
Tie1 T C 4: 118,472,865 T1054A possibly damaging Het
Tnfaip6 T G 2: 52,052,316 D212E probably benign Het
Tnxb A G 17: 34,690,192 T1442A probably damaging Het
Trim35 C T 14: 66,308,795 T337M probably damaging Het
Vipr1 T C 9: 121,669,423 V413A probably benign Het
Vmn1r19 C G 6: 57,404,593 Q44E probably damaging Het
Zfp689 T C 7: 127,444,724 S245G probably damaging Het
Other mutations in Zfp266
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4453001:Zfp266 UTSW 9 20506003 missense probably benign
R0744:Zfp266 UTSW 9 20499799 missense probably damaging 1.00
R0836:Zfp266 UTSW 9 20499799 missense probably damaging 1.00
R2180:Zfp266 UTSW 9 20499679 missense probably damaging 1.00
R2422:Zfp266 UTSW 9 20499262 missense possibly damaging 0.89
R3085:Zfp266 UTSW 9 20500944 missense probably damaging 0.99
R3791:Zfp266 UTSW 9 20499481 missense probably damaging 0.99
R3972:Zfp266 UTSW 9 20500150 missense probably damaging 1.00
R5378:Zfp266 UTSW 9 20499363 missense probably damaging 1.00
R5529:Zfp266 UTSW 9 20506734 missense probably damaging 0.99
R5788:Zfp266 UTSW 9 20506036 missense probably damaging 0.98
R6901:Zfp266 UTSW 9 20499599 nonsense probably null
R7326:Zfp266 UTSW 9 20502095 missense probably benign 0.03
R7417:Zfp266 UTSW 9 20500936 missense probably benign
R7783:Zfp266 UTSW 9 20500330 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ATTGATAGGGCTTCTCCTCAGTG -3'
(R):5'- TTTACTCAGTACTCGGGCCTTG -3'

Sequencing Primer
(F):5'- ATAGGGCTTCTCCTCAGTGTGAAC -3'
(R):5'- CACCCATGTACGAATTCATAGTGGAG -3'
Posted On2018-05-21