Incidental Mutation 'R6476:Slc9a9'
ID516796
Institutional Source Beutler Lab
Gene Symbol Slc9a9
Ensembl Gene ENSMUSG00000031129
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 9
Synonyms5730527A11Rik, Nhe9
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6476 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location94669909-95230445 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94685138 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 87 (F87L)
Ref Sequence ENSEMBL: ENSMUSP00000033463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033463]
Predicted Effect probably benign
Transcript: ENSMUST00000033463
AA Change: F87L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000033463
Gene: ENSMUSG00000031129
AA Change: F87L

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 28 486 2.6e-89 PFAM
low complexity region 594 600 N/A INTRINSIC
low complexity region 621 635 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162870
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium/proton exchanger that is a member of the solute carrier 9 protein family. The encoded protein localizes the to the late recycling endosomes and may play an important role in maintaining cation homeostasis. Mutations in this gene are associated with autism susceptibility 16 and attention-deficit/hyperactivity disorder. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A C 19: 5,503,225 I176S probably damaging Het
a T C 2: 155,050,779 V126A probably benign Het
Adamts20 T C 15: 94,361,810 Q336R probably benign Het
Ankrd36 A G 11: 5,628,753 T6A probably benign Het
Arhgap33 A G 7: 30,524,412 S731P probably damaging Het
Arhgef10l G C 4: 140,611,382 P23R probably damaging Het
Atf7 T C 15: 102,593,712 D3G probably benign Het
Caps2 A G 10: 112,175,560 T30A possibly damaging Het
Ccdc15 A T 9: 37,342,419 I191N probably benign Het
Cep170 A T 1: 176,780,351 S180T possibly damaging Het
Chd1 G A 17: 17,380,988 probably null Het
Col6a3 A T 1: 90,781,812 N1887K unknown Het
Csgalnact1 C T 8: 68,461,109 S148N probably damaging Het
Csgalnact1 T A 8: 68,461,110 S148C probably damaging Het
D10Jhu81e T C 10: 78,167,513 N102D probably damaging Het
Dnah14 A G 1: 181,744,768 E2888G probably benign Het
Dnah7b T A 1: 46,242,204 Y2808* probably null Het
Dock10 A C 1: 80,541,242 L1254* probably null Het
Eml2 T C 7: 19,196,311 V511A probably benign Het
Eml6 A G 11: 29,791,971 probably null Het
Erbin C A 13: 103,841,247 D601Y probably damaging Het
Fam35a T C 14: 34,268,014 S312G probably benign Het
Farsa A G 8: 84,857,180 E49G probably damaging Het
Fzd7 A G 1: 59,483,995 M346V probably damaging Het
Glg1 A C 8: 111,200,174 S170A possibly damaging Het
Gm21994 T C 2: 150,255,326 D61G probably benign Het
Gm340 C T 19: 41,583,079 T237I probably benign Het
Gpx3 A T 11: 54,907,199 I54F probably damaging Het
H6pd G A 4: 149,982,727 H401Y probably damaging Het
Hspb8 A G 5: 116,422,398 S28P probably damaging Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Krt9 A T 11: 100,190,814 D296E probably damaging Het
Lnx1 A G 5: 74,607,880 V349A possibly damaging Het
Map3k6 A T 4: 133,250,086 S915C probably damaging Het
Mecom C A 3: 29,980,568 A510S possibly damaging Het
Mettl14 A G 3: 123,374,037 I224T probably damaging Het
Mme T C 3: 63,343,635 probably null Het
Nbea T A 3: 56,004,806 T1187S probably benign Het
Ndor1 T C 2: 25,248,142 T444A possibly damaging Het
Nhlrc1 A G 13: 47,014,181 L200P possibly damaging Het
Npc1 G T 18: 12,201,694 S667* probably null Het
Olfr1009 T A 2: 85,721,584 Y60N probably damaging Het
Olfr1214 T A 2: 88,987,377 D275V probably benign Het
Olfr294 C T 7: 86,616,010 V212I probably benign Het
Olfr355 T A 2: 36,927,583 H177L possibly damaging Het
Olfr557 T A 7: 102,699,103 N288K possibly damaging Het
Pds5a A C 5: 65,634,287 I773R possibly damaging Het
Pgr T A 9: 8,964,838 probably null Het
Plscr4 A T 9: 92,490,766 M314L probably benign Het
Polr2m A G 9: 71,483,470 V46A probably benign Het
Ptk2b T A 14: 66,187,474 M174L possibly damaging Het
Sec31a A T 5: 100,386,149 F521I probably benign Het
Serpinb3d T C 1: 107,083,341 N47S probably benign Het
Slc17a2 C A 13: 23,812,586 H25N probably damaging Het
Slc24a3 T A 2: 145,606,830 D431E probably benign Het
Spata31 T A 13: 64,917,642 S54T possibly damaging Het
Spata6 T C 4: 111,774,823 S144P probably damaging Het
Sppl2c A G 11: 104,186,769 N132D probably benign Het
Ssu2 C T 6: 112,374,832 G311S probably damaging Het
Syne1 T A 10: 5,154,531 Q6328L possibly damaging Het
Tie1 T C 4: 118,472,865 T1054A possibly damaging Het
Tnfaip6 T G 2: 52,052,316 D212E probably benign Het
Tnxb A G 17: 34,690,192 T1442A probably damaging Het
Trim35 C T 14: 66,308,795 T337M probably damaging Het
Vipr1 T C 9: 121,669,423 V413A probably benign Het
Vmn1r19 C G 6: 57,404,593 Q44E probably damaging Het
Zfp266 G T 9: 20,499,281 H533Q probably damaging Het
Zfp689 T C 7: 127,444,724 S245G probably damaging Het
Other mutations in Slc9a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Slc9a9 APN 9 95055459 missense probably benign 0.03
IGL01394:Slc9a9 APN 9 95123037 missense probably benign
IGL01434:Slc9a9 APN 9 95019194 missense possibly damaging 0.49
IGL01715:Slc9a9 APN 9 94960446 missense probably damaging 1.00
IGL01821:Slc9a9 APN 9 95228950 missense probably benign
IGL02963:Slc9a9 APN 9 95020714 critical splice donor site probably null
IGL03211:Slc9a9 APN 9 95137990 splice site probably benign
ANU18:Slc9a9 UTSW 9 95055459 missense probably benign 0.03
R0306:Slc9a9 UTSW 9 95137934 missense probably benign
R0382:Slc9a9 UTSW 9 94685217 missense probably benign 0.18
R0388:Slc9a9 UTSW 9 94939563 critical splice donor site probably null
R1509:Slc9a9 UTSW 9 95228958 missense probably benign
R1785:Slc9a9 UTSW 9 95019193 missense possibly damaging 0.95
R4018:Slc9a9 UTSW 9 94685163 missense probably benign 0.03
R4167:Slc9a9 UTSW 9 95228899 missense probably damaging 0.98
R4170:Slc9a9 UTSW 9 95228899 missense probably damaging 0.98
R4695:Slc9a9 UTSW 9 94936449 critical splice donor site probably benign
R5400:Slc9a9 UTSW 9 94712901 missense probably damaging 1.00
R5609:Slc9a9 UTSW 9 94809937 missense probably damaging 1.00
R5684:Slc9a9 UTSW 9 95055508 missense possibly damaging 0.89
R6015:Slc9a9 UTSW 9 94939549 missense probably benign 0.29
R6102:Slc9a9 UTSW 9 94936429 missense probably benign 0.03
R6317:Slc9a9 UTSW 9 94939459 missense possibly damaging 0.51
R6398:Slc9a9 UTSW 9 94670227 missense probably benign 0.00
R6501:Slc9a9 UTSW 9 94936371 missense probably benign 0.01
R6603:Slc9a9 UTSW 9 94939546 missense probably damaging 0.98
R6611:Slc9a9 UTSW 9 94939478 missense probably benign 0.18
R6700:Slc9a9 UTSW 9 94936311 missense possibly damaging 0.66
R6824:Slc9a9 UTSW 9 95227198 missense probably damaging 1.00
R6931:Slc9a9 UTSW 9 94670086 missense possibly damaging 0.73
R6975:Slc9a9 UTSW 9 94960446 missense probably damaging 1.00
R6987:Slc9a9 UTSW 9 94669990 start gained probably benign
R7325:Slc9a9 UTSW 9 94712898 missense probably benign 0.24
R7374:Slc9a9 UTSW 9 95055489 missense possibly damaging 0.90
R7437:Slc9a9 UTSW 9 95228941 missense probably benign 0.00
R7614:Slc9a9 UTSW 9 94855739 missense probably damaging 1.00
R8412:Slc9a9 UTSW 9 95229039 missense probably damaging 1.00
R8501:Slc9a9 UTSW 9 94855739 missense probably damaging 1.00
R8514:Slc9a9 UTSW 9 94936365 missense probably benign 0.01
X0010:Slc9a9 UTSW 9 94685208 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- GTTCCAAGTCAAACGTGTGC -3'
(R):5'- CCAGTGTGACAATGTGAAAGC -3'

Sequencing Primer
(F):5'- TGCTTCAGTCAACTATGGGAGAC -3'
(R):5'- GGCGTATACCTATGTAAAGAGGCTTC -3'
Posted On2018-05-21