Incidental Mutation 'R6477:Tnni1'
ID516821
Institutional Source Beutler Lab
Gene Symbol Tnni1
Ensembl Gene ENSMUSG00000026418
Gene Nametroponin I, skeletal, slow 1
SynonymsssTnI, 2700018B22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6477 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location135779434-135810989 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135805566 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 42 (V42A)
Ref Sequence ENSEMBL: ENSMUSP00000122925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000132795] [ENSMUST00000139986] [ENSMUST00000148201] [ENSMUST00000152075] [ENSMUST00000152208] [ENSMUST00000154463]
Predicted Effect unknown
Transcript: ENSMUST00000129217
AA Change: V35A
SMART Domains Protein: ENSMUSP00000119848
Gene: ENSMUSG00000026418
AA Change: V35A

DomainStartEndE-ValueType
Pfam:Troponin 9 140 2.2e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132795
AA Change: V42A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121122
Gene: ENSMUSG00000026418
AA Change: V42A

DomainStartEndE-ValueType
Pfam:Troponin 15 60 7.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137331
Predicted Effect probably benign
Transcript: ENSMUST00000139986
AA Change: V26A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123049
Gene: ENSMUSG00000026418
AA Change: V26A

DomainStartEndE-ValueType
Pfam:Troponin 1 130 1.3e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148201
AA Change: V42A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000123509
Gene: ENSMUSG00000026418
AA Change: V42A

DomainStartEndE-ValueType
Pfam:Troponin 15 146 8.1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152075
AA Change: V42A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121343
Gene: ENSMUSG00000026418
AA Change: V42A

DomainStartEndE-ValueType
Pfam:Troponin 15 146 8.1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152208
AA Change: V42A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121966
Gene: ENSMUSG00000026418
AA Change: V42A

DomainStartEndE-ValueType
Pfam:Troponin 15 146 8.1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154463
AA Change: V42A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122925
Gene: ENSMUSG00000026418
AA Change: V42A

DomainStartEndE-ValueType
Pfam:Troponin 15 146 1.4e-49 PFAM
Meta Mutation Damage Score 0.0710 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Troponin proteins associate with tropomyosin and regulate the calcium sensitivity of the myofibril contractile apparatus of striated muscles. Troponin I (TnI), along with troponin T (TnT) and troponin C (TnC), is one of 3 subunits that form the troponin complex of the thin filaments of striated muscle. TnI is the inhibitory subunit; blocking actin-myosin interactions and thereby mediating striated muscle relaxation. The TnI subfamily contains three genes: TnI-skeletal-fast-twitch, TnI-skeletal-slow-twitch, and TnI-cardiac. The TnI-fast and TnI-slow genes are expressed in fast-twitch and slow-twitch skeletal muscle fibers, respectively, while the TnI-cardiac gene is expressed exclusively in cardiac muscle tissue. This gene encodes the Troponin-I-skeletal-slow-twitch protein. This gene is expressed in cardiac and skeletal muscle during early development but is restricted to slow-twitch skeletal muscle fibers in adults. The encoded protein prevents muscle contraction by inhibiting calcium-mediated conformational changes in actin-myosin complexes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,257,630 probably null Het
4933415F23Rik A T 1: 23,101,780 L151Q probably benign Het
Aatk T C 11: 120,018,870 D23G probably benign Het
Abca14 T C 7: 120,325,102 I1659T probably benign Het
Ankdd1a C T 9: 65,502,212 V481M probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Cfap161 T A 7: 83,794,022 R20* probably null Het
Cops7a A T 6: 124,960,176 V184E probably damaging Het
Cpa3 T C 3: 20,239,575 E83G possibly damaging Het
Crls1 C T 2: 132,861,233 S201L probably benign Het
Cyp4f39 C A 17: 32,481,817 S153R probably damaging Het
Ddx54 T A 5: 120,621,778 I410N probably damaging Het
Dido1 T A 2: 180,660,481 T1877S probably benign Het
Dip2c A G 13: 9,623,760 S1079G probably damaging Het
Dnhd1 G A 7: 105,677,886 V681I probably benign Het
Dst A G 1: 34,208,728 probably null Het
Eya2 A G 2: 165,763,761 T362A probably benign Het
Hgs G A 11: 120,469,655 V60M probably damaging Het
Inpp4b A G 8: 81,844,714 probably null Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Kdr C A 5: 75,968,841 A129S probably benign Het
Lhcgr A T 17: 88,742,373 M575K probably damaging Het
Lsamp G T 16: 42,168,165 probably benign Het
Mcm5 T C 8: 75,112,602 V161A probably benign Het
Mmp14 A T 14: 54,437,658 H249L probably damaging Het
Mroh5 A G 15: 73,790,755 S405P probably damaging Het
Mroh9 C A 1: 163,076,304 L46F probably damaging Het
Mtrr A T 13: 68,570,073 H357Q probably damaging Het
Myrf G A 19: 10,228,785 P89L probably benign Het
Mzb1 C T 18: 35,648,258 probably null Het
Naip6 A G 13: 100,316,008 S182P probably damaging Het
Nmur2 A T 11: 56,029,591 F276Y probably damaging Het
Nudt12 G T 17: 59,011,145 S35Y probably benign Het
Olfr1154 A G 2: 87,902,990 S229P probably damaging Het
Olfr572 T A 7: 102,928,378 V250E probably damaging Het
Olfr657 T C 7: 104,635,679 S2P probably benign Het
Osbpl1a T C 18: 12,756,261 I541V probably benign Het
Parp4 A G 14: 56,647,237 K1258E probably benign Het
Plcxd2 C G 16: 45,980,659 K67N probably damaging Het
Pnpla6 A G 8: 3,536,627 T930A probably benign Het
Pomt1 G A 2: 32,248,716 probably null Het
Pramel6 A G 2: 87,510,602 Y426C possibly damaging Het
Prss27 A G 17: 24,044,261 T83A probably damaging Het
Rbm27 T A 18: 42,333,318 V915E probably damaging Het
Rnf114 T A 2: 167,503,488 D10E probably benign Het
Sbk1 A G 7: 126,291,178 E121G probably damaging Het
Senp6 A T 9: 80,093,625 R39* probably null Het
Sergef A T 7: 46,633,826 I94N probably benign Het
Slc30a9 C T 5: 67,328,524 R183W probably benign Het
Smurf1 C T 5: 144,889,792 R414H possibly damaging Het
Sptb A T 12: 76,606,392 W1566R probably damaging Het
Tenm2 T C 11: 36,010,507 probably null Het
Tnxb A G 17: 34,719,539 Y3098C probably damaging Het
Ubald2 T C 11: 116,434,574 F46L probably benign Het
Ubqln5 G A 7: 104,128,258 S453F probably damaging Het
Ubr3 A T 2: 69,979,429 R1248* probably null Het
Utp20 A G 10: 88,768,918 V1705A probably benign Het
Zfp60 G A 7: 27,749,803 R632H probably benign Het
Zfp638 A G 6: 83,965,578 Y957C probably damaging Het
Zfp825 A T 13: 74,480,910 S162R possibly damaging Het
Zfp831 A C 2: 174,704,167 K1355T probably benign Het
Other mutations in Tnni1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Tnni1 APN 1 135805496 splice site probably null
R1758:Tnni1 UTSW 1 135808682 missense probably damaging 1.00
R2035:Tnni1 UTSW 1 135805592 missense probably benign 0.00
R3548:Tnni1 UTSW 1 135805053 critical splice acceptor site probably null
R5352:Tnni1 UTSW 1 135805592 missense probably benign 0.00
R7434:Tnni1 UTSW 1 135807522 missense
X0018:Tnni1 UTSW 1 135808720 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TAAACAAGCTTTGGTGGCAGC -3'
(R):5'- ACTTCCTGTGCAGTTGTGAG -3'

Sequencing Primer
(F):5'- TGCCACACTGAGCAATGG -3'
(R):5'- CCTGTGCAGTTGTGAGACTGG -3'
Posted On2018-05-21