Mutagenetix > Incidental Mutations

Incidental Mutation 'R6477:Ubr3'

516823

Institutional Source

Beutler Lab

Gene Symbol

Ubr3

Ensembl Gene

ENSMUSG00000044308

Gene Name

ubiquitin protein ligase E3 component n-recognin 3

Synonyms

Zfp650, 4833421P10Rik, A130030D10Rik, 1110059H15Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6477 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

69897246-70024013 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 69979429 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 1248 (R1248*)

Ref Sequence

ENSEMBL: ENSMUSP00000107870 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055758] [ENSMUST00000112251]

Predicted Effect

probably null
Transcript: ENSMUST00000055758
AA Change: R1249*

SMART Domains

Protein: ENSMUSP00000060159
Gene: ENSMUSG00000044308
AA Change: R1249*

Domain	Start	End	E-Value	Type
low complexity region	13	40	N/A	INTRINSIC
low complexity region	67	88	N/A	INTRINSIC
Pfam:zf-UBR	118	188	1.6e-19	PFAM
low complexity region	339	354	N/A	INTRINSIC
low complexity region	570	580	N/A	INTRINSIC
low complexity region	1016	1027	N/A	INTRINSIC
low complexity region	1082	1101	N/A	INTRINSIC
coiled coil region	1167	1199	N/A	INTRINSIC
Blast:RING	1289	1363	8e-39	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000112251
AA Change: R1248*

SMART Domains

Protein: ENSMUSP00000107870
Gene: ENSMUSG00000044308
AA Change: R1248*

Domain	Start	End	E-Value	Type
low complexity region	13	40	N/A	INTRINSIC
low complexity region	67	88	N/A	INTRINSIC
Pfam:zf-UBR	119	187	1.7e-21	PFAM
low complexity region	338	353	N/A	INTRINSIC
low complexity region	569	579	N/A	INTRINSIC
low complexity region	1015	1026	N/A	INTRINSIC
low complexity region	1081	1100	N/A	INTRINSIC
coiled coil region	1166	1198	N/A	INTRINSIC
Blast:RING	1288	1362	8e-39	BLAST

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.1%

Validation Efficiency

97% (60/62)

MGI Phenotype

PHENOTYPE: Homozygous null mice obtained on a coisogenic 129S1 background die early in embryogenesis while those on a mixed 129S1/B6 background are born at a slightly reduced frequency. On a congenic C57BL/6 background, homozygotes display neonatal lethality, impaired suckling and female behavioral anosmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	G	7: 34,257,630		probably null	Het
4933415F23Rik	A	T	1: 23,101,780	L151Q	probably benign	Het
Aatk	T	C	11: 120,018,870	D23G	probably benign	Het
Abca14	T	C	7: 120,325,102	I1659T	probably benign	Het
Ankdd1a	C	T	9: 65,502,212	V481M	probably benign	Het
Ankfy1	G	A	11: 72,730,482	R198Q	possibly damaging	Het
Cfap161	T	A	7: 83,794,022	R20*	probably null	Het
Cops7a	A	T	6: 124,960,176	V184E	probably damaging	Het
Cpa3	T	C	3: 20,239,575	E83G	possibly damaging	Het
Crls1	C	T	2: 132,861,233	S201L	probably benign	Het
Cyp4f39	C	A	17: 32,481,817	S153R	probably damaging	Het
Ddx54	T	A	5: 120,621,778	I410N	probably damaging	Het
Dido1	T	A	2: 180,660,481	T1877S	probably benign	Het
Dip2c	A	G	13: 9,623,760	S1079G	probably damaging	Het
Dnhd1	G	A	7: 105,677,886	V681I	probably benign	Het
Dst	A	G	1: 34,208,728		probably null	Het
Eya2	A	G	2: 165,763,761	T362A	probably benign	Het
Hgs	G	A	11: 120,469,655	V60M	probably damaging	Het
Inpp4b	A	G	8: 81,844,714		probably null	Het
Iqub	T	A	6: 24,449,745	N707I	probably damaging	Het
Kdr	C	A	5: 75,968,841	A129S	probably benign	Het
Lhcgr	A	T	17: 88,742,373	M575K	probably damaging	Het
Lsamp	G	T	16: 42,168,165		probably benign	Het
Mcm5	T	C	8: 75,112,602	V161A	probably benign	Het
Mmp14	A	T	14: 54,437,658	H249L	probably damaging	Het
Mroh5	A	G	15: 73,790,755	S405P	probably damaging	Het
Mroh9	C	A	1: 163,076,304	L46F	probably damaging	Het
Mtrr	A	T	13: 68,570,073	H357Q	probably damaging	Het
Myrf	G	A	19: 10,228,785	P89L	probably benign	Het
Mzb1	C	T	18: 35,648,258		probably null	Het
Naip6	A	G	13: 100,316,008	S182P	probably damaging	Het
Nmur2	A	T	11: 56,029,591	F276Y	probably damaging	Het
Nudt12	G	T	17: 59,011,145	S35Y	probably benign	Het
Olfr1154	A	G	2: 87,902,990	S229P	probably damaging	Het
Olfr572	T	A	7: 102,928,378	V250E	probably damaging	Het
Olfr657	T	C	7: 104,635,679	S2P	probably benign	Het
Osbpl1a	T	C	18: 12,756,261	I541V	probably benign	Het
Parp4	A	G	14: 56,647,237	K1258E	probably benign	Het
Plcxd2	C	G	16: 45,980,659	K67N	probably damaging	Het
Pnpla6	A	G	8: 3,536,627	T930A	probably benign	Het
Pomt1	G	A	2: 32,248,716		probably null	Het
Pramel6	A	G	2: 87,510,602	Y426C	possibly damaging	Het
Prss27	A	G	17: 24,044,261	T83A	probably damaging	Het
Rbm27	T	A	18: 42,333,318	V915E	probably damaging	Het
Rnf114	T	A	2: 167,503,488	D10E	probably benign	Het
Sbk1	A	G	7: 126,291,178	E121G	probably damaging	Het
Senp6	A	T	9: 80,093,625	R39*	probably null	Het
Sergef	A	T	7: 46,633,826	I94N	probably benign	Het
Slc30a9	C	T	5: 67,328,524	R183W	probably benign	Het
Smurf1	C	T	5: 144,889,792	R414H	possibly damaging	Het
Sptb	A	T	12: 76,606,392	W1566R	probably damaging	Het
Tenm2	T	C	11: 36,010,507		probably null	Het
Tnni1	T	C	1: 135,805,566	V42A	probably benign	Het
Tnxb	A	G	17: 34,719,539	Y3098C	probably damaging	Het
Ubald2	T	C	11: 116,434,574	F46L	probably benign	Het
Ubqln5	G	A	7: 104,128,258	S453F	probably damaging	Het
Utp20	A	G	10: 88,768,918	V1705A	probably benign	Het
Zfp60	G	A	7: 27,749,803	R632H	probably benign	Het
Zfp638	A	G	6: 83,965,578	Y957C	probably damaging	Het
Zfp825	A	T	13: 74,480,910	S162R	possibly damaging	Het
Zfp831	A	C	2: 174,704,167	K1355T	probably benign	Het

Other mutations in Ubr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Ubr3	APN	2	69988810	missense	probably benign	0.40
IGL00985:Ubr3	APN	2	70003431	missense	probably damaging	1.00
IGL01061:Ubr3	APN	2	69983225	missense	probably benign	0.05
IGL01325:Ubr3	APN	2	69917097	missense	possibly damaging	0.71
IGL01398:Ubr3	APN	2	69959653	missense	probably damaging	1.00
IGL01484:Ubr3	APN	2	70021544	nonsense	probably null
IGL01599:Ubr3	APN	2	69938178	missense	probably damaging	1.00
IGL01616:Ubr3	APN	2	70020484	missense	probably benign	0.14
IGL01634:Ubr3	APN	2	69973572	missense	probably benign
IGL01684:Ubr3	APN	2	70016158	nonsense	probably null
IGL01810:Ubr3	APN	2	70003465	splice site	probably null
IGL01813:Ubr3	APN	2	69951570	missense	probably benign	0.34
IGL01994:Ubr3	APN	2	70021176	missense	probably damaging	1.00
IGL02188:Ubr3	APN	2	69959611	nonsense	probably null
IGL02318:Ubr3	APN	2	69979397	missense	probably damaging	1.00
IGL02379:Ubr3	APN	2	69948488	missense	possibly damaging	0.91
IGL02635:Ubr3	APN	2	70020483	missense	probably damaging	0.96
IGL02858:Ubr3	APN	2	69952859	missense	probably damaging	1.00
IGL03140:Ubr3	APN	2	69970189	missense	probably damaging	1.00
IGL03343:Ubr3	APN	2	69973146	splice site	probably benign
Hyrax	UTSW	2	69952868	missense	probably benign	0.32
manatee	UTSW	2	69979386	nonsense	probably null
sea_cow	UTSW	2	69959669	splice site	probably null
R0094:Ubr3	UTSW	2	69951362	missense	probably damaging	1.00
R0094:Ubr3	UTSW	2	69951362	missense	probably damaging	1.00
R0122:Ubr3	UTSW	2	69979412	missense	probably damaging	1.00
R0243:Ubr3	UTSW	2	69951405	missense	probably damaging	1.00
R0710:Ubr3	UTSW	2	69952837	missense	probably damaging	1.00
R0787:Ubr3	UTSW	2	69951421	splice site	probably benign
R1137:Ubr3	UTSW	2	69938315	splice site	probably benign
R1191:Ubr3	UTSW	2	70021181	nonsense	probably null
R1416:Ubr3	UTSW	2	69945071	missense	probably damaging	1.00
R1623:Ubr3	UTSW	2	69977723	nonsense	probably null
R1735:Ubr3	UTSW	2	70009129	missense	probably damaging	1.00
R1789:Ubr3	UTSW	2	70016367	missense	possibly damaging	0.87
R1793:Ubr3	UTSW	2	70000551	splice site	probably benign
R1932:Ubr3	UTSW	2	69953476	splice site	probably null
R2042:Ubr3	UTSW	2	69977774	nonsense	probably null
R2085:Ubr3	UTSW	2	69953764	missense	probably damaging	1.00
R2090:Ubr3	UTSW	2	69936017	missense	probably damaging	1.00
R2112:Ubr3	UTSW	2	69977792	missense	possibly damaging	0.73
R2173:Ubr3	UTSW	2	69897399	missense	probably benign
R2215:Ubr3	UTSW	2	69979317	critical splice acceptor site	probably null
R2273:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2274:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2275:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2292:Ubr3	UTSW	2	69897260	unclassified	probably benign
R2447:Ubr3	UTSW	2	70003380	missense	probably damaging	1.00
R2504:Ubr3	UTSW	2	69938198	missense	probably damaging	0.99
R2517:Ubr3	UTSW	2	69936018	missense	probably damaging	1.00
R2901:Ubr3	UTSW	2	70016192	missense	possibly damaging	0.89
R3109:Ubr3	UTSW	2	69988840	missense	probably damaging	1.00
R3737:Ubr3	UTSW	2	69971234	critical splice donor site	probably null
R3793:Ubr3	UTSW	2	69917181	missense	possibly damaging	0.95
R3821:Ubr3	UTSW	2	69993813	critical splice donor site	probably null
R3918:Ubr3	UTSW	2	70016130	critical splice acceptor site	probably null
R4157:Ubr3	UTSW	2	69959669	splice site	probably null
R4235:Ubr3	UTSW	2	70016385	nonsense	probably null
R4276:Ubr3	UTSW	2	69938387	nonsense	probably null
R4544:Ubr3	UTSW	2	69956093	missense	probably benign	0.18
R4678:Ubr3	UTSW	2	69935919	missense	probably damaging	1.00
R4707:Ubr3	UTSW	2	69938370	intron	probably benign
R4785:Ubr3	UTSW	2	69959603	missense	probably damaging	1.00
R4872:Ubr3	UTSW	2	69970183	missense	probably damaging	1.00
R4887:Ubr3	UTSW	2	70013131	missense	probably damaging	0.99
R4920:Ubr3	UTSW	2	69952868	missense	probably benign	0.32
R4989:Ubr3	UTSW	2	70020446	splice site	probably benign
R5104:Ubr3	UTSW	2	69938256	missense	probably damaging	0.98
R5134:Ubr3	UTSW	2	70020446	splice site	probably benign
R5137:Ubr3	UTSW	2	69973335	missense	probably damaging	1.00
R5174:Ubr3	UTSW	2	70009162	missense	probably damaging	1.00
R5195:Ubr3	UTSW	2	69956034	missense	probably benign	0.00
R5437:Ubr3	UTSW	2	69944390	missense	probably damaging	1.00
R5539:Ubr3	UTSW	2	70020533	missense	probably damaging	1.00
R5781:Ubr3	UTSW	2	70016244	splice site	probably null
R5809:Ubr3	UTSW	2	69965511	missense	possibly damaging	0.90
R5913:Ubr3	UTSW	2	70021215	missense	probably damaging	1.00
R5969:Ubr3	UTSW	2	69979386	nonsense	probably null
R6136:Ubr3	UTSW	2	69993763	missense	probably benign	0.26
R6140:Ubr3	UTSW	2	69973329	missense	probably benign	0.09
R6185:Ubr3	UTSW	2	69938277	missense	probably damaging	0.98
R6220:Ubr3	UTSW	2	70020475	missense	probably damaging	1.00
R6258:Ubr3	UTSW	2	69982864	intron	probably null
R6319:Ubr3	UTSW	2	69973414	missense	probably benign	0.00
R6322:Ubr3	UTSW	2	69956085	nonsense	probably null
R6470:Ubr3	UTSW	2	69965460	missense	probably benign	0.02
R6702:Ubr3	UTSW	2	69956049	missense	probably benign	0.23
R6709:Ubr3	UTSW	2	70013092	missense	probably damaging	1.00
R6803:Ubr3	UTSW	2	69936024	critical splice donor site	probably null
R6806:Ubr3	UTSW	2	69955964	splice site	probably benign
R6834:Ubr3	UTSW	2	70000481	missense	possibly damaging	0.63
R6841:Ubr3	UTSW	2	70020625	missense	probably damaging	1.00
R6847:Ubr3	UTSW	2	69983128	missense	probably damaging	1.00
R6889:Ubr3	UTSW	2	69944300	missense	possibly damaging	0.70
R7065:Ubr3	UTSW	2	69953705	missense	probably damaging	1.00
R7102:Ubr3	UTSW	2	69897822	missense	probably damaging	1.00
R7156:Ubr3	UTSW	2	70021623	missense	probably damaging	1.00
R7209:Ubr3	UTSW	2	70016134	missense	probably benign	0.01
R7273:Ubr3	UTSW	2	69979333	missense	probably damaging	0.97
R7314:Ubr3	UTSW	2	69991600	missense	probably damaging	1.00
R7422:Ubr3	UTSW	2	69953542	critical splice donor site	probably null
R7584:Ubr3	UTSW	2	69991503	missense	probably damaging	1.00
R7588:Ubr3	UTSW	2	69971169	missense	probably damaging	1.00
R7597:Ubr3	UTSW	2	69973468	missense	possibly damaging	0.69
R7697:Ubr3	UTSW	2	69897686	missense	probably damaging	1.00
R7737:Ubr3	UTSW	2	69991566	missense	probably benign	0.07
R7743:Ubr3	UTSW	2	69944449	missense	probably benign	0.28
Z1088:Ubr3	UTSW	2	69922367	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AAATAGATCTTTGTGGGGAGTGCA -3'
(R):5'- GCATGCTATTTCAAGAACCCCA -3'

Sequencing Primer
(F):5'- TGCATAATGAAGAGGGACTTTCC -3'
(R):5'- TTAAATGGGCAACACTGATAGACC -3'

Posted On

2018-05-21