Incidental Mutation 'R6477:Slc30a9'
ID516831
Institutional Source Beutler Lab
Gene Symbol Slc30a9
Ensembl Gene ENSMUSG00000029221
Gene Namesolute carrier family 30 (zinc transporter), member 9
Synonyms2310024J23Rik, GAC63
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.927) question?
Stock #R6477 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location67306955-67358443 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 67328524 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 183 (R183W)
Ref Sequence ENSEMBL: ENSMUSP00000109306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113676] [ENSMUST00000162372] [ENSMUST00000202521]
Predicted Effect probably benign
Transcript: ENSMUST00000113676
AA Change: R183W

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000109306
Gene: ENSMUSG00000029221
AA Change: R183W

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
PDB:2ENK|A 103 196 2e-54 PDB
SCOP:d1d4ua1 106 174 3e-28 SMART
Pfam:Cation_efflux 219 547 1.6e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161169
Predicted Effect probably benign
Transcript: ENSMUST00000162372
AA Change: R203W

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000124047
Gene: ENSMUSG00000029221
AA Change: R203W

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
PDB:2ENK|A 123 216 2e-54 PDB
SCOP:d1d4ua1 126 194 5e-28 SMART
Pfam:Cation_efflux 239 449 1e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200734
Predicted Effect probably benign
Transcript: ENSMUST00000202521
Predicted Effect probably benign
Transcript: ENSMUST00000202770
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 97% (60/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,257,630 probably null Het
4933415F23Rik A T 1: 23,101,780 L151Q probably benign Het
Aatk T C 11: 120,018,870 D23G probably benign Het
Abca14 T C 7: 120,325,102 I1659T probably benign Het
Ankdd1a C T 9: 65,502,212 V481M probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Cfap161 T A 7: 83,794,022 R20* probably null Het
Cops7a A T 6: 124,960,176 V184E probably damaging Het
Cpa3 T C 3: 20,239,575 E83G possibly damaging Het
Crls1 C T 2: 132,861,233 S201L probably benign Het
Cyp4f39 C A 17: 32,481,817 S153R probably damaging Het
Ddx54 T A 5: 120,621,778 I410N probably damaging Het
Dido1 T A 2: 180,660,481 T1877S probably benign Het
Dip2c A G 13: 9,623,760 S1079G probably damaging Het
Dnhd1 G A 7: 105,677,886 V681I probably benign Het
Dst A G 1: 34,208,728 probably null Het
Eya2 A G 2: 165,763,761 T362A probably benign Het
Hgs G A 11: 120,469,655 V60M probably damaging Het
Inpp4b A G 8: 81,844,714 probably null Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Kdr C A 5: 75,968,841 A129S probably benign Het
Lhcgr A T 17: 88,742,373 M575K probably damaging Het
Lsamp G T 16: 42,168,165 probably benign Het
Mcm5 T C 8: 75,112,602 V161A probably benign Het
Mmp14 A T 14: 54,437,658 H249L probably damaging Het
Mroh5 A G 15: 73,790,755 S405P probably damaging Het
Mroh9 C A 1: 163,076,304 L46F probably damaging Het
Mtrr A T 13: 68,570,073 H357Q probably damaging Het
Myrf G A 19: 10,228,785 P89L probably benign Het
Mzb1 C T 18: 35,648,258 probably null Het
Naip6 A G 13: 100,316,008 S182P probably damaging Het
Nmur2 A T 11: 56,029,591 F276Y probably damaging Het
Nudt12 G T 17: 59,011,145 S35Y probably benign Het
Olfr1154 A G 2: 87,902,990 S229P probably damaging Het
Olfr572 T A 7: 102,928,378 V250E probably damaging Het
Olfr657 T C 7: 104,635,679 S2P probably benign Het
Osbpl1a T C 18: 12,756,261 I541V probably benign Het
Parp4 A G 14: 56,647,237 K1258E probably benign Het
Plcxd2 C G 16: 45,980,659 K67N probably damaging Het
Pnpla6 A G 8: 3,536,627 T930A probably benign Het
Pomt1 G A 2: 32,248,716 probably null Het
Pramel6 A G 2: 87,510,602 Y426C possibly damaging Het
Prss27 A G 17: 24,044,261 T83A probably damaging Het
Rbm27 T A 18: 42,333,318 V915E probably damaging Het
Rnf114 T A 2: 167,503,488 D10E probably benign Het
Sbk1 A G 7: 126,291,178 E121G probably damaging Het
Senp6 A T 9: 80,093,625 R39* probably null Het
Sergef A T 7: 46,633,826 I94N probably benign Het
Smurf1 C T 5: 144,889,792 R414H possibly damaging Het
Sptb A T 12: 76,606,392 W1566R probably damaging Het
Tenm2 T C 11: 36,010,507 probably null Het
Tnni1 T C 1: 135,805,566 V42A probably benign Het
Tnxb A G 17: 34,719,539 Y3098C probably damaging Het
Ubald2 T C 11: 116,434,574 F46L probably benign Het
Ubqln5 G A 7: 104,128,258 S453F probably damaging Het
Ubr3 A T 2: 69,979,429 R1248* probably null Het
Utp20 A G 10: 88,768,918 V1705A probably benign Het
Zfp60 G A 7: 27,749,803 R632H probably benign Het
Zfp638 A G 6: 83,965,578 Y957C probably damaging Het
Zfp825 A T 13: 74,480,910 S162R possibly damaging Het
Zfp831 A C 2: 174,704,167 K1355T probably benign Het
Other mutations in Slc30a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Slc30a9 APN 5 67342109 missense probably damaging 1.00
IGL00975:Slc30a9 APN 5 67349826 missense probably damaging 1.00
IGL01129:Slc30a9 APN 5 67342143 missense probably damaging 1.00
IGL01377:Slc30a9 APN 5 67315830 missense probably benign
IGL01785:Slc30a9 APN 5 67346238 splice site probably benign
IGL01786:Slc30a9 APN 5 67346238 splice site probably benign
IGL02407:Slc30a9 APN 5 67352722 missense probably damaging 1.00
IGL03185:Slc30a9 APN 5 67333063 missense probably benign
IGL03276:Slc30a9 APN 5 67349917 splice site probably benign
IGL03380:Slc30a9 APN 5 67315711 missense probably benign 0.04
ANU74:Slc30a9 UTSW 5 67349852 missense probably damaging 1.00
R0539:Slc30a9 UTSW 5 67334610 missense probably damaging 1.00
R1401:Slc30a9 UTSW 5 67352662 missense probably benign
R1554:Slc30a9 UTSW 5 67326921 missense probably damaging 1.00
R1824:Slc30a9 UTSW 5 67348052 missense probably damaging 1.00
R2029:Slc30a9 UTSW 5 67339975 nonsense probably null
R4385:Slc30a9 UTSW 5 67315767 missense probably damaging 1.00
R4704:Slc30a9 UTSW 5 67342273 intron probably benign
R4868:Slc30a9 UTSW 5 67324683 missense probably benign
R4907:Slc30a9 UTSW 5 67346162 missense probably damaging 1.00
R5553:Slc30a9 UTSW 5 67345604 intron probably null
R6002:Slc30a9 UTSW 5 67342117 missense probably damaging 1.00
R6718:Slc30a9 UTSW 5 67333100 missense probably damaging 1.00
R7113:Slc30a9 UTSW 5 67326862 missense probably benign 0.17
R7224:Slc30a9 UTSW 5 67315701 missense probably benign
R7327:Slc30a9 UTSW 5 67342119 missense probably damaging 1.00
R7394:Slc30a9 UTSW 5 67352766 critical splice donor site probably null
R7467:Slc30a9 UTSW 5 67345644 missense probably benign 0.08
R7514:Slc30a9 UTSW 5 67348078 missense possibly damaging 0.68
R8020:Slc30a9 UTSW 5 67307033 start gained probably benign
Z1176:Slc30a9 UTSW 5 67339958 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCAGAACATTGTGGATACGTG -3'
(R):5'- GTCACACAGAAACTACAAAGTGTTTCC -3'

Sequencing Primer
(F):5'- TTGCTTACATTTGACTCAGACAC -3'
(R):5'- ACTACAAAGTGTTTCCTTTTACTTCC -3'
Posted On2018-05-21