Incidental Mutation 'R6477:Kdr'
ID516832
Institutional Source Beutler Lab
Gene Symbol Kdr
Ensembl Gene ENSMUSG00000062960
Gene Namekinase insert domain protein receptor
SynonymsFlk1, vascular endothelial growth factor receptor- 2, VEGF receptor-2, VEGFR2, VEGFR-2, Flk-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6477 (G1)
Quality Score190.009
Status Validated
Chromosome5
Chromosomal Location75932827-75978458 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 75968841 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 129 (A129S)
Ref Sequence ENSEMBL: ENSMUSP00000109144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113516]
Predicted Effect probably benign
Transcript: ENSMUST00000113516
AA Change: A129S

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000109144
Gene: ENSMUSG00000062960
AA Change: A129S

DomainStartEndE-ValueType
IG 38 121 2.43e-2 SMART
IG_like 137 220 5.91e1 SMART
IG 233 327 2.64e-12 SMART
IG 339 420 1.2e-6 SMART
IG 432 546 2.14e0 SMART
IG 554 657 2.79e-2 SMART
IGc2 677 742 8.42e-20 SMART
TyrKc 832 1158 7.07e-138 SMART
low complexity region 1310 1315 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202473
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vascular endothelial growth factor (VEGF) is a major growth factor for endothelial cells. This gene encodes one of the two receptors of the VEGF. This receptor, known as kinase insert domain receptor, is a type III receptor tyrosine kinase. It functions as the main mediator of VEGF-induced endothelial proliferation, survival, migration, tubular morphogenesis and sprouting. The signalling and trafficking of this receptor are regulated by multiple factors, including Rab GTPase, P2Y purine nucleotide receptor, integrin alphaVbeta3, T-cell protein tyrosine phosphatase, etc.. Mutations of this gene are implicated in infantile capillary hemangiomas. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous mice die at early embryonic stages due to failure of blood vessel formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,257,630 probably null Het
4933415F23Rik A T 1: 23,101,780 L151Q probably benign Het
Aatk T C 11: 120,018,870 D23G probably benign Het
Abca14 T C 7: 120,325,102 I1659T probably benign Het
Ankdd1a C T 9: 65,502,212 V481M probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Cfap161 T A 7: 83,794,022 R20* probably null Het
Cops7a A T 6: 124,960,176 V184E probably damaging Het
Cpa3 T C 3: 20,239,575 E83G possibly damaging Het
Crls1 C T 2: 132,861,233 S201L probably benign Het
Cyp4f39 C A 17: 32,481,817 S153R probably damaging Het
Ddx54 T A 5: 120,621,778 I410N probably damaging Het
Dido1 T A 2: 180,660,481 T1877S probably benign Het
Dip2c A G 13: 9,623,760 S1079G probably damaging Het
Dnhd1 G A 7: 105,677,886 V681I probably benign Het
Dst A G 1: 34,208,728 probably null Het
Eya2 A G 2: 165,763,761 T362A probably benign Het
Hgs G A 11: 120,469,655 V60M probably damaging Het
Inpp4b A G 8: 81,844,714 probably null Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Lhcgr A T 17: 88,742,373 M575K probably damaging Het
Lsamp G T 16: 42,168,165 probably benign Het
Mcm5 T C 8: 75,112,602 V161A probably benign Het
Mmp14 A T 14: 54,437,658 H249L probably damaging Het
Mroh5 A G 15: 73,790,755 S405P probably damaging Het
Mroh9 C A 1: 163,076,304 L46F probably damaging Het
Mtrr A T 13: 68,570,073 H357Q probably damaging Het
Myrf G A 19: 10,228,785 P89L probably benign Het
Mzb1 C T 18: 35,648,258 probably null Het
Naip6 A G 13: 100,316,008 S182P probably damaging Het
Nmur2 A T 11: 56,029,591 F276Y probably damaging Het
Nudt12 G T 17: 59,011,145 S35Y probably benign Het
Olfr1154 A G 2: 87,902,990 S229P probably damaging Het
Olfr572 T A 7: 102,928,378 V250E probably damaging Het
Olfr657 T C 7: 104,635,679 S2P probably benign Het
Osbpl1a T C 18: 12,756,261 I541V probably benign Het
Parp4 A G 14: 56,647,237 K1258E probably benign Het
Plcxd2 C G 16: 45,980,659 K67N probably damaging Het
Pnpla6 A G 8: 3,536,627 T930A probably benign Het
Pomt1 G A 2: 32,248,716 probably null Het
Pramel6 A G 2: 87,510,602 Y426C possibly damaging Het
Prss27 A G 17: 24,044,261 T83A probably damaging Het
Rbm27 T A 18: 42,333,318 V915E probably damaging Het
Rnf114 T A 2: 167,503,488 D10E probably benign Het
Sbk1 A G 7: 126,291,178 E121G probably damaging Het
Senp6 A T 9: 80,093,625 R39* probably null Het
Sergef A T 7: 46,633,826 I94N probably benign Het
Slc30a9 C T 5: 67,328,524 R183W probably benign Het
Smurf1 C T 5: 144,889,792 R414H possibly damaging Het
Sptb A T 12: 76,606,392 W1566R probably damaging Het
Tenm2 T C 11: 36,010,507 probably null Het
Tnni1 T C 1: 135,805,566 V42A probably benign Het
Tnxb A G 17: 34,719,539 Y3098C probably damaging Het
Ubald2 T C 11: 116,434,574 F46L probably benign Het
Ubqln5 G A 7: 104,128,258 S453F probably damaging Het
Ubr3 A T 2: 69,979,429 R1248* probably null Het
Utp20 A G 10: 88,768,918 V1705A probably benign Het
Zfp60 G A 7: 27,749,803 R632H probably benign Het
Zfp638 A G 6: 83,965,578 Y957C probably damaging Het
Zfp825 A T 13: 74,480,910 S162R possibly damaging Het
Zfp831 A C 2: 174,704,167 K1355T probably benign Het
Other mutations in Kdr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Kdr APN 5 75968750 missense probably damaging 1.00
IGL01094:Kdr APN 5 75961760 missense probably benign 0.00
IGL01310:Kdr APN 5 75949601 missense probably damaging 1.00
IGL01689:Kdr APN 5 75936840 missense probably benign 0.01
IGL01986:Kdr APN 5 75952859 missense probably benign 0.18
IGL02065:Kdr APN 5 75961853 splice site probably benign
IGL02200:Kdr APN 5 75950102 splice site probably benign
IGL02272:Kdr APN 5 75961840 missense probably benign
IGL02426:Kdr APN 5 75974466 missense probably benign 0.00
IGL02483:Kdr APN 5 75936294 critical splice donor site probably null
IGL02543:Kdr APN 5 75964947 splice site probably benign
IGL02590:Kdr APN 5 75936323 missense probably benign 0.00
IGL03204:Kdr APN 5 75972382 missense possibly damaging 0.96
IGL03228:Kdr APN 5 75957048 missense probably damaging 0.97
IGL03265:Kdr APN 5 75960773 missense probably damaging 1.00
engelein UTSW 5 75952889 missense probably damaging 1.00
PIT4131001:Kdr UTSW 5 75941971 splice site probably benign
PIT4519001:Kdr UTSW 5 75936896 missense possibly damaging 0.86
R0133:Kdr UTSW 5 75951838 missense probably damaging 1.00
R0197:Kdr UTSW 5 75968422 missense possibly damaging 0.82
R0282:Kdr UTSW 5 75950100 splice site probably benign
R0309:Kdr UTSW 5 75946927 splice site probably benign
R0371:Kdr UTSW 5 75941834 missense probably benign 0.22
R0396:Kdr UTSW 5 75960728 missense possibly damaging 0.65
R0498:Kdr UTSW 5 75959138 missense probably benign 0.00
R0932:Kdr UTSW 5 75968805 missense probably benign 0.02
R1077:Kdr UTSW 5 75956231 missense probably damaging 1.00
R1183:Kdr UTSW 5 75946851 missense probably damaging 1.00
R1713:Kdr UTSW 5 75968467 missense probably benign 0.03
R1853:Kdr UTSW 5 75952905 missense possibly damaging 0.67
R1854:Kdr UTSW 5 75952905 missense possibly damaging 0.67
R2142:Kdr UTSW 5 75968423 missense possibly damaging 0.56
R2238:Kdr UTSW 5 75949519 missense possibly damaging 0.78
R2891:Kdr UTSW 5 75946836 missense probably damaging 1.00
R2893:Kdr UTSW 5 75946836 missense probably damaging 1.00
R2894:Kdr UTSW 5 75946836 missense probably damaging 1.00
R2903:Kdr UTSW 5 75966409 missense probably damaging 1.00
R2904:Kdr UTSW 5 75966409 missense probably damaging 1.00
R3155:Kdr UTSW 5 75968405 missense probably benign 0.02
R3939:Kdr UTSW 5 75972429 nonsense probably null
R4051:Kdr UTSW 5 75968408 missense probably benign
R4151:Kdr UTSW 5 75957101 missense possibly damaging 0.94
R4433:Kdr UTSW 5 75943925 missense possibly damaging 0.61
R4687:Kdr UTSW 5 75968792 missense possibly damaging 0.81
R4691:Kdr UTSW 5 75944599 missense possibly damaging 0.79
R5185:Kdr UTSW 5 75952417 splice site probably null
R5544:Kdr UTSW 5 75960743 nonsense probably null
R6083:Kdr UTSW 5 75944366 missense probably damaging 1.00
R6568:Kdr UTSW 5 75961774 missense probably benign 0.01
R6647:Kdr UTSW 5 75952889 missense probably damaging 1.00
R6827:Kdr UTSW 5 75944545 missense probably damaging 1.00
R6887:Kdr UTSW 5 75968451 missense probably benign 0.00
R6929:Kdr UTSW 5 75978104 missense probably benign 0.16
R6993:Kdr UTSW 5 75972411 missense probably benign
R7022:Kdr UTSW 5 75972260 nonsense probably null
R7050:Kdr UTSW 5 75950120 missense probably damaging 1.00
R7099:Kdr UTSW 5 75944333 missense probably damaging 0.98
R7274:Kdr UTSW 5 75964700 missense probably benign 0.00
R7310:Kdr UTSW 5 75944325 missense probably damaging 0.99
R7565:Kdr UTSW 5 75948843 missense probably damaging 0.97
X0024:Kdr UTSW 5 75974406 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTATGGGAGCTTTGTAATTCACTG -3'
(R):5'- AGCCAGATAGCTATGTGCAG -3'

Sequencing Primer
(F):5'- TTGAAAGTGGGAAGCTCATCTCC -3'
(R):5'- ATAGCTATGTGCAGACTAGCCTG -3'
Posted On2018-05-21