Incidental Mutation 'R6477:Smurf1'
ID516834
Institutional Source Beutler Lab
Gene Symbol Smurf1
Ensembl Gene ENSMUSG00000038780
Gene NameSMAD specific E3 ubiquitin protein ligase 1
Synonyms4930431E10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6477 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location144876495-144965847 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 144889792 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 414 (R414H)
Ref Sequence ENSEMBL: ENSMUSP00000106305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085684] [ENSMUST00000100461] [ENSMUST00000110677]
Predicted Effect probably benign
Transcript: ENSMUST00000085684
AA Change: R388H

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000082827
Gene: ENSMUSG00000038780
AA Change: R388H

DomainStartEndE-ValueType
C2 14 117 3.03e-15 SMART
low complexity region 185 193 N/A INTRINSIC
WW 235 267 1.06e-7 SMART
WW 281 313 8.66e-13 SMART
HECTc 392 731 3.48e-160 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100461
AA Change: R388H

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000098029
Gene: ENSMUSG00000038780
AA Change: R388H

DomainStartEndE-ValueType
C2 14 117 3.03e-15 SMART
low complexity region 185 193 N/A INTRINSIC
WW 235 267 1.06e-7 SMART
WW 281 313 8.66e-13 SMART
HECTc 392 728 2.72e-162 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110677
AA Change: R414H

PolyPhen 2 Score 0.492 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106305
Gene: ENSMUSG00000038780
AA Change: R414H

DomainStartEndE-ValueType
C2 14 117 3.03e-15 SMART
low complexity region 185 193 N/A INTRINSIC
WW 235 267 1.06e-7 SMART
WW 307 339 8.66e-13 SMART
HECTc 418 757 3.48e-160 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126822
Predicted Effect unknown
Transcript: ENSMUST00000198621
AA Change: R183H
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin ligase that is specific for receptor-regulated SMAD proteins in the bone morphogenetic protein (BMP) pathway. This protein plays a key roll in the regulation of cell motility, cell signalling, and cell polarity. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for one knock-out allele display increased osteoblast function, bone density, and thickness of the cortical bone in long bones. Mice homozygous for a different knock-out allele are viable and only display gastrulation defects in combination with a Smurf2 knock-out allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,257,630 probably null Het
4933415F23Rik A T 1: 23,101,780 L151Q probably benign Het
Aatk T C 11: 120,018,870 D23G probably benign Het
Abca14 T C 7: 120,325,102 I1659T probably benign Het
Ankdd1a C T 9: 65,502,212 V481M probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Cfap161 T A 7: 83,794,022 R20* probably null Het
Cops7a A T 6: 124,960,176 V184E probably damaging Het
Cpa3 T C 3: 20,239,575 E83G possibly damaging Het
Crls1 C T 2: 132,861,233 S201L probably benign Het
Cyp4f39 C A 17: 32,481,817 S153R probably damaging Het
Ddx54 T A 5: 120,621,778 I410N probably damaging Het
Dido1 T A 2: 180,660,481 T1877S probably benign Het
Dip2c A G 13: 9,623,760 S1079G probably damaging Het
Dnhd1 G A 7: 105,677,886 V681I probably benign Het
Dst A G 1: 34,208,728 probably null Het
Eya2 A G 2: 165,763,761 T362A probably benign Het
Hgs G A 11: 120,469,655 V60M probably damaging Het
Inpp4b A G 8: 81,844,714 probably null Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Kdr C A 5: 75,968,841 A129S probably benign Het
Lhcgr A T 17: 88,742,373 M575K probably damaging Het
Lsamp G T 16: 42,168,165 probably benign Het
Mcm5 T C 8: 75,112,602 V161A probably benign Het
Mmp14 A T 14: 54,437,658 H249L probably damaging Het
Mroh5 A G 15: 73,790,755 S405P probably damaging Het
Mroh9 C A 1: 163,076,304 L46F probably damaging Het
Mtrr A T 13: 68,570,073 H357Q probably damaging Het
Myrf G A 19: 10,228,785 P89L probably benign Het
Mzb1 C T 18: 35,648,258 probably null Het
Naip6 A G 13: 100,316,008 S182P probably damaging Het
Nmur2 A T 11: 56,029,591 F276Y probably damaging Het
Nudt12 G T 17: 59,011,145 S35Y probably benign Het
Olfr1154 A G 2: 87,902,990 S229P probably damaging Het
Olfr572 T A 7: 102,928,378 V250E probably damaging Het
Olfr657 T C 7: 104,635,679 S2P probably benign Het
Osbpl1a T C 18: 12,756,261 I541V probably benign Het
Parp4 A G 14: 56,647,237 K1258E probably benign Het
Plcxd2 C G 16: 45,980,659 K67N probably damaging Het
Pnpla6 A G 8: 3,536,627 T930A probably benign Het
Pomt1 G A 2: 32,248,716 probably null Het
Pramel6 A G 2: 87,510,602 Y426C possibly damaging Het
Prss27 A G 17: 24,044,261 T83A probably damaging Het
Rbm27 T A 18: 42,333,318 V915E probably damaging Het
Rnf114 T A 2: 167,503,488 D10E probably benign Het
Sbk1 A G 7: 126,291,178 E121G probably damaging Het
Senp6 A T 9: 80,093,625 R39* probably null Het
Sergef A T 7: 46,633,826 I94N probably benign Het
Slc30a9 C T 5: 67,328,524 R183W probably benign Het
Sptb A T 12: 76,606,392 W1566R probably damaging Het
Tenm2 T C 11: 36,010,507 probably null Het
Tnni1 T C 1: 135,805,566 V42A probably benign Het
Tnxb A G 17: 34,719,539 Y3098C probably damaging Het
Ubald2 T C 11: 116,434,574 F46L probably benign Het
Ubqln5 G A 7: 104,128,258 S453F probably damaging Het
Ubr3 A T 2: 69,979,429 R1248* probably null Het
Utp20 A G 10: 88,768,918 V1705A probably benign Het
Zfp60 G A 7: 27,749,803 R632H probably benign Het
Zfp638 A G 6: 83,965,578 Y957C probably damaging Het
Zfp825 A T 13: 74,480,910 S162R possibly damaging Het
Zfp831 A C 2: 174,704,167 K1355T probably benign Het
Other mutations in Smurf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Smurf1 APN 5 144881774 missense probably benign 0.00
IGL01577:Smurf1 APN 5 144893188 missense probably damaging 0.99
IGL02232:Smurf1 APN 5 144886438 missense probably damaging 1.00
IGL02407:Smurf1 APN 5 144884724 missense probably damaging 1.00
IGL02959:Smurf1 APN 5 144899389 missense probably damaging 1.00
IGL02997:Smurf1 APN 5 144898005 nonsense probably null
IGL03227:Smurf1 APN 5 144899182 missense probably damaging 1.00
IGL03293:Smurf1 APN 5 144881799 missense probably benign
R1563:Smurf1 UTSW 5 144882513 missense probably damaging 1.00
R1652:Smurf1 UTSW 5 144880664 missense probably damaging 1.00
R2698:Smurf1 UTSW 5 144883562 unclassified probably benign
R3794:Smurf1 UTSW 5 144901175 critical splice donor site probably null
R4274:Smurf1 UTSW 5 144896775 intron probably benign
R4282:Smurf1 UTSW 5 144882593 missense probably damaging 1.00
R4287:Smurf1 UTSW 5 144891458 missense probably benign 0.00
R4643:Smurf1 UTSW 5 144879369 missense probably damaging 1.00
R4723:Smurf1 UTSW 5 144893184 missense probably damaging 1.00
R5496:Smurf1 UTSW 5 144882593 nonsense probably null
R5702:Smurf1 UTSW 5 144901211 missense possibly damaging 0.96
R5846:Smurf1 UTSW 5 144879380 missense probably damaging 1.00
R6107:Smurf1 UTSW 5 144894504 missense possibly damaging 0.75
R6263:Smurf1 UTSW 5 144881731 missense probably damaging 0.96
R6548:Smurf1 UTSW 5 144899497 missense probably damaging 1.00
R6584:Smurf1 UTSW 5 144882523 missense probably damaging 0.97
R6981:Smurf1 UTSW 5 144886369 missense possibly damaging 0.69
R7062:Smurf1 UTSW 5 144893546 intron probably null
R7900:Smurf1 UTSW 5 144899373 missense probably damaging 1.00
R7983:Smurf1 UTSW 5 144899373 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACTGTGACACTCAGGAAG -3'
(R):5'- GTCTTGTCTCTGGGAAGAAGAAGG -3'

Sequencing Primer
(F):5'- ACTCAGGAAGTGGGCAGCTC -3'
(R):5'- GTAGAGCCTCTGCCTAGAATC -3'
Posted On2018-05-21