Incidental Mutation 'R6477:Zfp638'
ID516836
Institutional Source Beutler Lab
Gene Symbol Zfp638
Ensembl Gene ENSMUSG00000030016
Gene Namezinc finger protein 638
SynonymsNp220, Zfml
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.887) question?
Stock #R6477 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location83867109-83989550 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83965578 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 957 (Y957C)
Ref Sequence ENSEMBL: ENSMUSP00000144989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032088] [ENSMUST00000113835] [ENSMUST00000113836] [ENSMUST00000203324] [ENSMUST00000203455] [ENSMUST00000203891] [ENSMUST00000204751]
Predicted Effect unknown
Transcript: ENSMUST00000032088
AA Change: Y957C
SMART Domains Protein: ENSMUSP00000032088
Gene: ENSMUSG00000030016
AA Change: Y957C

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 9.04e-3 SMART
Blast:RRM_2 1007 1075 4e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1399 1412 N/A INTRINSIC
low complexity region 1512 1526 N/A INTRINSIC
low complexity region 1761 1771 N/A INTRINSIC
ZnF_U1 1873 1907 2.84e-8 SMART
ZnF_C2H2 1876 1900 2.14e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113835
AA Change: Y934C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109466
Gene: ENSMUSG00000030016
AA Change: Y934C

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 880 949 9.04e-3 SMART
Blast:RRM_2 984 1052 2e-25 BLAST
low complexity region 1095 1109 N/A INTRINSIC
ZnF_U1 1218 1252 2.84e-8 SMART
ZnF_C2H2 1221 1245 2.14e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113836
AA Change: Y957C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109467
Gene: ENSMUSG00000030016
AA Change: Y957C

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 9.04e-3 SMART
Blast:RRM_2 1007 1075 2e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
ZnF_U1 1222 1256 2.84e-8 SMART
ZnF_C2H2 1225 1249 2.14e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203324
AA Change: Y957C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145124
Gene: ENSMUSG00000030016
AA Change: Y957C

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 3.5e-2 SMART
ZnF_C2H2 424 448 5.9e-2 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 9.1e-9 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 3.9e-5 SMART
Blast:RRM_2 1007 1075 2e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
ZnF_U1 1220 1254 1.7e-10 SMART
ZnF_C2H2 1223 1247 8.9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203455
SMART Domains Protein: ENSMUSP00000145047
Gene: ENSMUSG00000030016

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
internal_repeat_1 819 891 3.29e-10 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203481
Predicted Effect probably damaging
Transcript: ENSMUST00000203891
AA Change: Y957C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144939
Gene: ENSMUSG00000030016
AA Change: Y957C

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 3.5e-2 SMART
ZnF_C2H2 424 448 5.9e-2 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 9.1e-9 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 3.9e-5 SMART
Blast:RRM_2 1007 1075 2e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
ZnF_U1 1186 1220 1.7e-10 SMART
ZnF_C2H2 1189 1213 8.9e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204120
Predicted Effect probably damaging
Transcript: ENSMUST00000204751
AA Change: Y957C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144989
Gene: ENSMUSG00000030016
AA Change: Y957C

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 9.04e-3 SMART
Blast:RRM_2 1007 1075 4e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1399 1412 N/A INTRINSIC
low complexity region 1512 1526 N/A INTRINSIC
low complexity region 1761 1771 N/A INTRINSIC
ZnF_U1 1873 1907 2.84e-8 SMART
ZnF_C2H2 1876 1900 2.14e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204953
Predicted Effect unknown
Transcript: ENSMUST00000205166
AA Change: Y142C
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nucleoplasmic protein. It binds cytidine-rich sequences in double-stranded DNA. This protein has three types of domains: MH1, MH2 (repeated three times) and MH3. It is associated with packaging, transferring, or processing transcripts. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,257,630 probably null Het
4933415F23Rik A T 1: 23,101,780 L151Q probably benign Het
Aatk T C 11: 120,018,870 D23G probably benign Het
Abca14 T C 7: 120,325,102 I1659T probably benign Het
Ankdd1a C T 9: 65,502,212 V481M probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Cfap161 T A 7: 83,794,022 R20* probably null Het
Cops7a A T 6: 124,960,176 V184E probably damaging Het
Cpa3 T C 3: 20,239,575 E83G possibly damaging Het
Crls1 C T 2: 132,861,233 S201L probably benign Het
Cyp4f39 C A 17: 32,481,817 S153R probably damaging Het
Ddx54 T A 5: 120,621,778 I410N probably damaging Het
Dido1 T A 2: 180,660,481 T1877S probably benign Het
Dip2c A G 13: 9,623,760 S1079G probably damaging Het
Dnhd1 G A 7: 105,677,886 V681I probably benign Het
Dst A G 1: 34,208,728 probably null Het
Eya2 A G 2: 165,763,761 T362A probably benign Het
Hgs G A 11: 120,469,655 V60M probably damaging Het
Inpp4b A G 8: 81,844,714 probably null Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Kdr C A 5: 75,968,841 A129S probably benign Het
Lhcgr A T 17: 88,742,373 M575K probably damaging Het
Lsamp G T 16: 42,168,165 probably benign Het
Mcm5 T C 8: 75,112,602 V161A probably benign Het
Mmp14 A T 14: 54,437,658 H249L probably damaging Het
Mroh5 A G 15: 73,790,755 S405P probably damaging Het
Mroh9 C A 1: 163,076,304 L46F probably damaging Het
Mtrr A T 13: 68,570,073 H357Q probably damaging Het
Myrf G A 19: 10,228,785 P89L probably benign Het
Mzb1 C T 18: 35,648,258 probably null Het
Naip6 A G 13: 100,316,008 S182P probably damaging Het
Nmur2 A T 11: 56,029,591 F276Y probably damaging Het
Nudt12 G T 17: 59,011,145 S35Y probably benign Het
Olfr1154 A G 2: 87,902,990 S229P probably damaging Het
Olfr572 T A 7: 102,928,378 V250E probably damaging Het
Olfr657 T C 7: 104,635,679 S2P probably benign Het
Osbpl1a T C 18: 12,756,261 I541V probably benign Het
Parp4 A G 14: 56,647,237 K1258E probably benign Het
Plcxd2 C G 16: 45,980,659 K67N probably damaging Het
Pnpla6 A G 8: 3,536,627 T930A probably benign Het
Pomt1 G A 2: 32,248,716 probably null Het
Pramel6 A G 2: 87,510,602 Y426C possibly damaging Het
Prss27 A G 17: 24,044,261 T83A probably damaging Het
Rbm27 T A 18: 42,333,318 V915E probably damaging Het
Rnf114 T A 2: 167,503,488 D10E probably benign Het
Sbk1 A G 7: 126,291,178 E121G probably damaging Het
Senp6 A T 9: 80,093,625 R39* probably null Het
Sergef A T 7: 46,633,826 I94N probably benign Het
Slc30a9 C T 5: 67,328,524 R183W probably benign Het
Smurf1 C T 5: 144,889,792 R414H possibly damaging Het
Sptb A T 12: 76,606,392 W1566R probably damaging Het
Tenm2 T C 11: 36,010,507 probably null Het
Tnni1 T C 1: 135,805,566 V42A probably benign Het
Tnxb A G 17: 34,719,539 Y3098C probably damaging Het
Ubald2 T C 11: 116,434,574 F46L probably benign Het
Ubqln5 G A 7: 104,128,258 S453F probably damaging Het
Ubr3 A T 2: 69,979,429 R1248* probably null Het
Utp20 A G 10: 88,768,918 V1705A probably benign Het
Zfp60 G A 7: 27,749,803 R632H probably benign Het
Zfp825 A T 13: 74,480,910 S162R possibly damaging Het
Zfp831 A C 2: 174,704,167 K1355T probably benign Het
Other mutations in Zfp638
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Zfp638 APN 6 83979718 missense probably damaging 1.00
IGL00514:Zfp638 APN 6 83956698 missense probably damaging 1.00
IGL00705:Zfp638 APN 6 83977130 missense probably damaging 1.00
IGL00785:Zfp638 APN 6 83929164 missense probably damaging 1.00
IGL01068:Zfp638 APN 6 83934994 missense probably damaging 1.00
IGL01084:Zfp638 APN 6 83944798 missense probably benign 0.01
IGL01570:Zfp638 APN 6 83947847 missense probably damaging 1.00
IGL01758:Zfp638 APN 6 83979526 missense probably damaging 0.96
IGL02345:Zfp638 APN 6 83984875 missense probably damaging 1.00
IGL02939:Zfp638 APN 6 83969232 missense probably damaging 0.98
IGL03007:Zfp638 APN 6 83984884 missense probably damaging 1.00
IGL03118:Zfp638 APN 6 83935018 splice site probably benign
IGL03135:Zfp638 APN 6 83942875 missense probably damaging 1.00
IGL03264:Zfp638 APN 6 83946247 missense probably benign 0.04
R0190:Zfp638 UTSW 6 83928964 missense probably damaging 1.00
R0200:Zfp638 UTSW 6 83967354 missense probably damaging 1.00
R0766:Zfp638 UTSW 6 83929041 missense probably damaging 1.00
R0801:Zfp638 UTSW 6 83972238 unclassified probably benign
R0938:Zfp638 UTSW 6 83984041 missense probably benign 0.16
R1312:Zfp638 UTSW 6 83929041 missense probably damaging 1.00
R1458:Zfp638 UTSW 6 83944656 missense probably damaging 1.00
R1584:Zfp638 UTSW 6 83978065 intron probably null
R1634:Zfp638 UTSW 6 83979912 splice site probably null
R1651:Zfp638 UTSW 6 83954737 missense probably benign 0.00
R2079:Zfp638 UTSW 6 83953389 critical splice donor site probably null
R2134:Zfp638 UTSW 6 83928982 missense probably damaging 1.00
R2142:Zfp638 UTSW 6 83986596 missense probably damaging 1.00
R2201:Zfp638 UTSW 6 83929518 missense probably damaging 1.00
R2422:Zfp638 UTSW 6 83966439 splice site probably benign
R4353:Zfp638 UTSW 6 83984059 missense probably damaging 0.97
R4681:Zfp638 UTSW 6 83981737 missense possibly damaging 0.50
R4716:Zfp638 UTSW 6 83979562 nonsense probably null
R4807:Zfp638 UTSW 6 83943058 missense probably damaging 1.00
R4850:Zfp638 UTSW 6 83979475 missense possibly damaging 0.92
R5079:Zfp638 UTSW 6 83929456 missense probably benign 0.03
R5236:Zfp638 UTSW 6 83976575 nonsense probably null
R5323:Zfp638 UTSW 6 83962094 missense probably damaging 0.96
R5426:Zfp638 UTSW 6 83976414 missense probably damaging 1.00
R5557:Zfp638 UTSW 6 83967363 missense probably damaging 1.00
R5570:Zfp638 UTSW 6 83979188 missense probably damaging 1.00
R5614:Zfp638 UTSW 6 83929641 missense probably damaging 1.00
R5662:Zfp638 UTSW 6 83943129 missense probably damaging 0.97
R5685:Zfp638 UTSW 6 83929987 missense probably damaging 1.00
R5689:Zfp638 UTSW 6 83929072 missense probably damaging 1.00
R5783:Zfp638 UTSW 6 83944847 missense possibly damaging 0.92
R5856:Zfp638 UTSW 6 83977065 missense probably damaging 1.00
R6310:Zfp638 UTSW 6 83867230 missense possibly damaging 0.90
R6557:Zfp638 UTSW 6 83930110 missense probably damaging 1.00
R7084:Zfp638 UTSW 6 83953126 missense possibly damaging 0.50
R7101:Zfp638 UTSW 6 83954726 missense probably benign 0.00
R7141:Zfp638 UTSW 6 83867199 missense unknown
R7368:Zfp638 UTSW 6 83929455 missense possibly damaging 0.60
R7402:Zfp638 UTSW 6 83928688 missense possibly damaging 0.92
R7455:Zfp638 UTSW 6 83930145 missense probably damaging 1.00
R7762:Zfp638 UTSW 6 83976272 missense probably damaging 1.00
R7773:Zfp638 UTSW 6 83979214 missense probably damaging 1.00
Z1088:Zfp638 UTSW 6 83944811 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTACTGTTAAGTTAGTCATAGCC -3'
(R):5'- TTAAAAGTGGGCTCAGTGGTCAG -3'

Sequencing Primer
(F):5'- AGTCATAGCCCATGGACTTTG -3'
(R):5'- TTGTAGCTCAAAAACACTGTGACCG -3'
Posted On2018-05-21