Incidental Mutation 'R6477:Sergef'
ID516840
Institutional Source Beutler Lab
Gene Symbol Sergef
Ensembl Gene ENSMUSG00000030839
Gene Namesecretion regulating guanine nucleotide exchange factor
SynonymsGnefr, Gef, DelGEF
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.328) question?
Stock #R6477 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location46443154-46639807 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46633826 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 94 (I94N)
Ref Sequence ENSEMBL: ENSMUSP00000033127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033127] [ENSMUST00000135035] [ENSMUST00000216505]
Predicted Effect probably benign
Transcript: ENSMUST00000033127
AA Change: I94N

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000033127
Gene: ENSMUSG00000030839
AA Change: I94N

DomainStartEndE-ValueType
Pfam:RCC1 16 64 7.3e-13 PFAM
Pfam:RCC1_2 51 80 8e-8 PFAM
Pfam:RCC1 67 116 3.9e-11 PFAM
Pfam:RCC1_2 103 132 6.4e-11 PFAM
Pfam:RCC1 119 168 3.3e-10 PFAM
Pfam:RCC1_2 213 243 2.3e-10 PFAM
Pfam:RCC1 230 279 7.5e-8 PFAM
Pfam:RCC1 283 348 5.8e-12 PFAM
Pfam:RCC1 351 401 7.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125825
Predicted Effect probably benign
Transcript: ENSMUST00000135035
AA Change: I151N

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000116461
Gene: ENSMUSG00000030839
AA Change: I151N

DomainStartEndE-ValueType
Pfam:RCC1 78 121 1.5e-9 PFAM
Pfam:RCC1_2 108 137 1.8e-8 PFAM
Pfam:RCC1 124 173 2.2e-11 PFAM
Pfam:RCC1_2 160 189 4.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137988
Predicted Effect probably benign
Transcript: ENSMUST00000216505
AA Change: I94N

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 97% (60/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,257,630 probably null Het
4933415F23Rik A T 1: 23,101,780 L151Q probably benign Het
Aatk T C 11: 120,018,870 D23G probably benign Het
Abca14 T C 7: 120,325,102 I1659T probably benign Het
Ankdd1a C T 9: 65,502,212 V481M probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Cfap161 T A 7: 83,794,022 R20* probably null Het
Cops7a A T 6: 124,960,176 V184E probably damaging Het
Cpa3 T C 3: 20,239,575 E83G possibly damaging Het
Crls1 C T 2: 132,861,233 S201L probably benign Het
Cyp4f39 C A 17: 32,481,817 S153R probably damaging Het
Ddx54 T A 5: 120,621,778 I410N probably damaging Het
Dido1 T A 2: 180,660,481 T1877S probably benign Het
Dip2c A G 13: 9,623,760 S1079G probably damaging Het
Dnhd1 G A 7: 105,677,886 V681I probably benign Het
Dst A G 1: 34,208,728 probably null Het
Eya2 A G 2: 165,763,761 T362A probably benign Het
Hgs G A 11: 120,469,655 V60M probably damaging Het
Inpp4b A G 8: 81,844,714 probably null Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Kdr C A 5: 75,968,841 A129S probably benign Het
Lhcgr A T 17: 88,742,373 M575K probably damaging Het
Lsamp G T 16: 42,168,165 probably benign Het
Mcm5 T C 8: 75,112,602 V161A probably benign Het
Mmp14 A T 14: 54,437,658 H249L probably damaging Het
Mroh5 A G 15: 73,790,755 S405P probably damaging Het
Mroh9 C A 1: 163,076,304 L46F probably damaging Het
Mtrr A T 13: 68,570,073 H357Q probably damaging Het
Myrf G A 19: 10,228,785 P89L probably benign Het
Mzb1 C T 18: 35,648,258 probably null Het
Naip6 A G 13: 100,316,008 S182P probably damaging Het
Nmur2 A T 11: 56,029,591 F276Y probably damaging Het
Nudt12 G T 17: 59,011,145 S35Y probably benign Het
Olfr1154 A G 2: 87,902,990 S229P probably damaging Het
Olfr572 T A 7: 102,928,378 V250E probably damaging Het
Olfr657 T C 7: 104,635,679 S2P probably benign Het
Osbpl1a T C 18: 12,756,261 I541V probably benign Het
Parp4 A G 14: 56,647,237 K1258E probably benign Het
Plcxd2 C G 16: 45,980,659 K67N probably damaging Het
Pnpla6 A G 8: 3,536,627 T930A probably benign Het
Pomt1 G A 2: 32,248,716 probably null Het
Pramel6 A G 2: 87,510,602 Y426C possibly damaging Het
Prss27 A G 17: 24,044,261 T83A probably damaging Het
Rbm27 T A 18: 42,333,318 V915E probably damaging Het
Rnf114 T A 2: 167,503,488 D10E probably benign Het
Sbk1 A G 7: 126,291,178 E121G probably damaging Het
Senp6 A T 9: 80,093,625 R39* probably null Het
Slc30a9 C T 5: 67,328,524 R183W probably benign Het
Smurf1 C T 5: 144,889,792 R414H possibly damaging Het
Sptb A T 12: 76,606,392 W1566R probably damaging Het
Tenm2 T C 11: 36,010,507 probably null Het
Tnni1 T C 1: 135,805,566 V42A probably benign Het
Tnxb A G 17: 34,719,539 Y3098C probably damaging Het
Ubald2 T C 11: 116,434,574 F46L probably benign Het
Ubqln5 G A 7: 104,128,258 S453F probably damaging Het
Ubr3 A T 2: 69,979,429 R1248* probably null Het
Utp20 A G 10: 88,768,918 V1705A probably benign Het
Zfp60 G A 7: 27,749,803 R632H probably benign Het
Zfp638 A G 6: 83,965,578 Y957C probably damaging Het
Zfp825 A T 13: 74,480,910 S162R possibly damaging Het
Zfp831 A C 2: 174,704,167 K1355T probably benign Het
Other mutations in Sergef
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Sergef APN 7 46635420 critical splice donor site probably null
IGL00864:Sergef APN 7 46515663 splice site probably null
IGL01529:Sergef APN 7 46443518 missense probably damaging 1.00
IGL03014:Sergef UTSW 7 46590756 missense probably damaging 1.00
R0472:Sergef UTSW 7 46633746 splice site probably benign
R1604:Sergef UTSW 7 46443359 missense probably benign 0.00
R1892:Sergef UTSW 7 46614616 critical splice donor site probably null
R3955:Sergef UTSW 7 46618752 missense possibly damaging 0.95
R4032:Sergef UTSW 7 46443302 nonsense probably null
R4953:Sergef UTSW 7 46633835 missense probably benign 0.01
R5140:Sergef UTSW 7 46635602 intron probably benign
R5533:Sergef UTSW 7 46614776 missense possibly damaging 0.94
R5697:Sergef UTSW 7 46639259 intron probably benign
R5930:Sergef UTSW 7 46443464 missense probably benign 0.03
R6725:Sergef UTSW 7 46632667 unclassified probably null
R7511:Sergef UTSW 7 46614746 missense probably damaging 1.00
R8052:Sergef UTSW 7 46614638 missense probably damaging 1.00
Z1177:Sergef UTSW 7 46639617 intron probably benign
Predicted Primers PCR Primer
(F):5'- TCCCTACATGGCTATAGAGAACAC -3'
(R):5'- TCTGTGGCTCCAAGTGACTC -3'

Sequencing Primer
(F):5'- CATGGCTATAGAGAACACTTGTG -3'
(R):5'- TGGCTCCAAGTGACTCATGGTAAC -3'
Posted On2018-05-21