Incidental Mutation 'R6477:Ankdd1a'
ID516850
Institutional Source Beutler Lab
Gene Symbol Ankdd1a
Ensembl Gene ENSMUSG00000066510
Gene Nameankyrin repeat and death domain containing 1A
SynonymsLOC384945
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R6477 (G1)
Quality Score161.009
Status Validated
Chromosome9
Chromosomal Location65488470-65520193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 65502212 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 481 (V481M)
Ref Sequence ENSEMBL: ENSMUSP00000150130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061766] [ENSMUST00000217646]
Predicted Effect probably benign
Transcript: ENSMUST00000061766
AA Change: V452M

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000057040
Gene: ENSMUSG00000066510
AA Change: V452M

DomainStartEndE-ValueType
ANK 4 33 1.31e3 SMART
ANK 37 66 2.1e-3 SMART
ANK 70 99 6.26e-2 SMART
ANK 103 132 8.72e-1 SMART
ANK 138 167 5.09e-2 SMART
ANK 171 200 4.03e-5 SMART
ANK 204 233 5.32e-5 SMART
ANK 237 268 8.72e-1 SMART
ANK 270 299 8.99e-3 SMART
ANK 303 332 1.23e0 SMART
ANK 336 364 1.4e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217144
Predicted Effect probably benign
Transcript: ENSMUST00000217646
AA Change: V481M

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 97% (60/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,257,630 probably null Het
4933415F23Rik A T 1: 23,101,780 L151Q probably benign Het
Aatk T C 11: 120,018,870 D23G probably benign Het
Abca14 T C 7: 120,325,102 I1659T probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Cfap161 T A 7: 83,794,022 R20* probably null Het
Cops7a A T 6: 124,960,176 V184E probably damaging Het
Cpa3 T C 3: 20,239,575 E83G possibly damaging Het
Crls1 C T 2: 132,861,233 S201L probably benign Het
Cyp4f39 C A 17: 32,481,817 S153R probably damaging Het
Ddx54 T A 5: 120,621,778 I410N probably damaging Het
Dido1 T A 2: 180,660,481 T1877S probably benign Het
Dip2c A G 13: 9,623,760 S1079G probably damaging Het
Dnhd1 G A 7: 105,677,886 V681I probably benign Het
Dst A G 1: 34,208,728 probably null Het
Eya2 A G 2: 165,763,761 T362A probably benign Het
Hgs G A 11: 120,469,655 V60M probably damaging Het
Inpp4b A G 8: 81,844,714 probably null Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Kdr C A 5: 75,968,841 A129S probably benign Het
Lhcgr A T 17: 88,742,373 M575K probably damaging Het
Lsamp G T 16: 42,168,165 probably benign Het
Mcm5 T C 8: 75,112,602 V161A probably benign Het
Mmp14 A T 14: 54,437,658 H249L probably damaging Het
Mroh5 A G 15: 73,790,755 S405P probably damaging Het
Mroh9 C A 1: 163,076,304 L46F probably damaging Het
Mtrr A T 13: 68,570,073 H357Q probably damaging Het
Myrf G A 19: 10,228,785 P89L probably benign Het
Mzb1 C T 18: 35,648,258 probably null Het
Naip6 A G 13: 100,316,008 S182P probably damaging Het
Nmur2 A T 11: 56,029,591 F276Y probably damaging Het
Nudt12 G T 17: 59,011,145 S35Y probably benign Het
Olfr1154 A G 2: 87,902,990 S229P probably damaging Het
Olfr572 T A 7: 102,928,378 V250E probably damaging Het
Olfr657 T C 7: 104,635,679 S2P probably benign Het
Osbpl1a T C 18: 12,756,261 I541V probably benign Het
Parp4 A G 14: 56,647,237 K1258E probably benign Het
Plcxd2 C G 16: 45,980,659 K67N probably damaging Het
Pnpla6 A G 8: 3,536,627 T930A probably benign Het
Pomt1 G A 2: 32,248,716 probably null Het
Pramel6 A G 2: 87,510,602 Y426C possibly damaging Het
Prss27 A G 17: 24,044,261 T83A probably damaging Het
Rbm27 T A 18: 42,333,318 V915E probably damaging Het
Rnf114 T A 2: 167,503,488 D10E probably benign Het
Sbk1 A G 7: 126,291,178 E121G probably damaging Het
Senp6 A T 9: 80,093,625 R39* probably null Het
Sergef A T 7: 46,633,826 I94N probably benign Het
Slc30a9 C T 5: 67,328,524 R183W probably benign Het
Smurf1 C T 5: 144,889,792 R414H possibly damaging Het
Sptb A T 12: 76,606,392 W1566R probably damaging Het
Tenm2 T C 11: 36,010,507 probably null Het
Tnni1 T C 1: 135,805,566 V42A probably benign Het
Tnxb A G 17: 34,719,539 Y3098C probably damaging Het
Ubald2 T C 11: 116,434,574 F46L probably benign Het
Ubqln5 G A 7: 104,128,258 S453F probably damaging Het
Ubr3 A T 2: 69,979,429 R1248* probably null Het
Utp20 A G 10: 88,768,918 V1705A probably benign Het
Zfp60 G A 7: 27,749,803 R632H probably benign Het
Zfp638 A G 6: 83,965,578 Y957C probably damaging Het
Zfp825 A T 13: 74,480,910 S162R possibly damaging Het
Zfp831 A C 2: 174,704,167 K1355T probably benign Het
Other mutations in Ankdd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Ankdd1a APN 9 65508702 missense probably damaging 1.00
IGL01372:Ankdd1a APN 9 65504139 missense probably damaging 1.00
IGL01932:Ankdd1a APN 9 65507611 splice site probably benign
IGL02150:Ankdd1a APN 9 65512719 missense probably damaging 1.00
IGL03243:Ankdd1a APN 9 65501470 missense probably benign 0.28
PIT4618001:Ankdd1a UTSW 9 65507650 missense possibly damaging 0.76
R0137:Ankdd1a UTSW 9 65510328 missense probably null 0.26
R0302:Ankdd1a UTSW 9 65509642 splice site probably benign
R0980:Ankdd1a UTSW 9 65516971 missense probably damaging 1.00
R1832:Ankdd1a UTSW 9 65504489 critical splice donor site probably null
R3887:Ankdd1a UTSW 9 65502248 missense probably damaging 1.00
R4470:Ankdd1a UTSW 9 65503509 missense probably damaging 1.00
R4471:Ankdd1a UTSW 9 65503509 missense probably damaging 1.00
R5326:Ankdd1a UTSW 9 65504190 critical splice acceptor site probably null
R5394:Ankdd1a UTSW 9 65505214 missense probably benign 0.12
R5542:Ankdd1a UTSW 9 65504190 critical splice acceptor site probably null
R5594:Ankdd1a UTSW 9 65502241 missense probably damaging 1.00
R5933:Ankdd1a UTSW 9 65509696 missense probably benign 0.11
R6217:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6294:Ankdd1a UTSW 9 65520164 missense probably benign 0.12
R6300:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6301:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6305:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6306:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6307:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6312:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6313:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6314:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6413:Ankdd1a UTSW 9 65510372 missense probably benign
R6431:Ankdd1a UTSW 9 65516938 missense possibly damaging 0.92
R6991:Ankdd1a UTSW 9 65508675 missense probably benign 0.22
R7260:Ankdd1a UTSW 9 65504552 missense probably damaging 0.96
R7586:Ankdd1a UTSW 9 65502184 critical splice donor site probably null
X0064:Ankdd1a UTSW 9 65503453 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCAGAAGGCTCAACTCATCC -3'
(R):5'- AGAGAAGGGCGTCTTTCCAG -3'

Sequencing Primer
(F):5'- CAGAGACAATTGGGGATTATAGTGTC -3'
(R):5'- CTTTCCAGCTGGGTGCATGC -3'
Posted On2018-05-21