Incidental Mutation 'R6477:Mtrr'
ID516860
Institutional Source Beutler Lab
Gene Symbol Mtrr
Ensembl Gene ENSMUSG00000034617
Gene Name5-methyltetrahydrofolate-homocysteine methyltransferase reductase
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_172480; MGI: 1891037

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6477 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location68560780-68582149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 68570073 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 357 (H357Q)
Ref Sequence ENSEMBL: ENSMUSP00000152387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045827] [ENSMUST00000223101] [ENSMUST00000223398]
Predicted Effect probably damaging
Transcript: ENSMUST00000045827
AA Change: H357Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000039810
Gene: ENSMUSG00000034617
AA Change: H357Q

DomainStartEndE-ValueType
Pfam:Flavodoxin_5 5 126 2.7e-9 PFAM
Pfam:Flavodoxin_1 6 142 4.3e-32 PFAM
Pfam:FAD_binding_1 267 490 2.6e-51 PFAM
Pfam:NAD_binding_1 540 660 5.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220544
Predicted Effect probably benign
Transcript: ENSMUST00000223101
Predicted Effect probably damaging
Transcript: ENSMUST00000223398
AA Change: H357Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: Methionine is an essential amino acid required for protein synthesis and one-carbon metabolism. Its synthesis is catalyzed by the enzyme methionine synthase. Methionine synthase eventually becomes inactive due to the oxidation of its cob(I)alamin cofactor. The protein encoded by this gene regenerates a functional methionine synthase via reductive methylation. It is a member of the ferredoxin-NADP(+) reductase (FNR) family of electron transferases. Mutations in a similar gene in human have been associated with cblE complementation type homocystinuria-megaloblastic anemia and susceptibility to folate-sensitive neural tube defects. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for a hypomorphic gene trap allele are viable and display a male-specific reduction in postnatal weight gain as well as hyperhomocysteinemia, hypomethionemia, increased tissue methyltetrahydrofolate, and AdoMet/AdoHcy ratios that range from high to slightly below normal. [provided by MGI curators]
Allele List at MGI

All alleles(46) : Gene trapped(46)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,257,630 probably null Het
4933415F23Rik A T 1: 23,101,780 L151Q probably benign Het
Aatk T C 11: 120,018,870 D23G probably benign Het
Abca14 T C 7: 120,325,102 I1659T probably benign Het
Ankdd1a C T 9: 65,502,212 V481M probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Cfap161 T A 7: 83,794,022 R20* probably null Het
Cops7a A T 6: 124,960,176 V184E probably damaging Het
Cpa3 T C 3: 20,239,575 E83G possibly damaging Het
Crls1 C T 2: 132,861,233 S201L probably benign Het
Cyp4f39 C A 17: 32,481,817 S153R probably damaging Het
Ddx54 T A 5: 120,621,778 I410N probably damaging Het
Dido1 T A 2: 180,660,481 T1877S probably benign Het
Dip2c A G 13: 9,623,760 S1079G probably damaging Het
Dnhd1 G A 7: 105,677,886 V681I probably benign Het
Dst A G 1: 34,208,728 probably null Het
Eya2 A G 2: 165,763,761 T362A probably benign Het
Hgs G A 11: 120,469,655 V60M probably damaging Het
Inpp4b A G 8: 81,844,714 probably null Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Kdr C A 5: 75,968,841 A129S probably benign Het
Lhcgr A T 17: 88,742,373 M575K probably damaging Het
Lsamp G T 16: 42,168,165 probably benign Het
Mcm5 T C 8: 75,112,602 V161A probably benign Het
Mmp14 A T 14: 54,437,658 H249L probably damaging Het
Mroh5 A G 15: 73,790,755 S405P probably damaging Het
Mroh9 C A 1: 163,076,304 L46F probably damaging Het
Myrf G A 19: 10,228,785 P89L probably benign Het
Mzb1 C T 18: 35,648,258 probably null Het
Naip6 A G 13: 100,316,008 S182P probably damaging Het
Nmur2 A T 11: 56,029,591 F276Y probably damaging Het
Nudt12 G T 17: 59,011,145 S35Y probably benign Het
Olfr1154 A G 2: 87,902,990 S229P probably damaging Het
Olfr572 T A 7: 102,928,378 V250E probably damaging Het
Olfr657 T C 7: 104,635,679 S2P probably benign Het
Osbpl1a T C 18: 12,756,261 I541V probably benign Het
Parp4 A G 14: 56,647,237 K1258E probably benign Het
Plcxd2 C G 16: 45,980,659 K67N probably damaging Het
Pnpla6 A G 8: 3,536,627 T930A probably benign Het
Pomt1 G A 2: 32,248,716 probably null Het
Pramel6 A G 2: 87,510,602 Y426C possibly damaging Het
Prss27 A G 17: 24,044,261 T83A probably damaging Het
Rbm27 T A 18: 42,333,318 V915E probably damaging Het
Rnf114 T A 2: 167,503,488 D10E probably benign Het
Sbk1 A G 7: 126,291,178 E121G probably damaging Het
Senp6 A T 9: 80,093,625 R39* probably null Het
Sergef A T 7: 46,633,826 I94N probably benign Het
Slc30a9 C T 5: 67,328,524 R183W probably benign Het
Smurf1 C T 5: 144,889,792 R414H possibly damaging Het
Sptb A T 12: 76,606,392 W1566R probably damaging Het
Tenm2 T C 11: 36,010,507 probably null Het
Tnni1 T C 1: 135,805,566 V42A probably benign Het
Tnxb A G 17: 34,719,539 Y3098C probably damaging Het
Ubald2 T C 11: 116,434,574 F46L probably benign Het
Ubqln5 G A 7: 104,128,258 S453F probably damaging Het
Ubr3 A T 2: 69,979,429 R1248* probably null Het
Utp20 A G 10: 88,768,918 V1705A probably benign Het
Zfp60 G A 7: 27,749,803 R632H probably benign Het
Zfp638 A G 6: 83,965,578 Y957C probably damaging Het
Zfp825 A T 13: 74,480,910 S162R possibly damaging Het
Zfp831 A C 2: 174,704,167 K1355T probably benign Het
Other mutations in Mtrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01787:Mtrr APN 13 68571147 missense probably damaging 1.00
IGL01806:Mtrr APN 13 68580600 missense possibly damaging 0.92
IGL01808:Mtrr APN 13 68566093 missense probably benign 0.00
IGL01875:Mtrr APN 13 68572609 missense probably damaging 1.00
IGL02137:Mtrr APN 13 68568801 missense possibly damaging 0.75
IGL02186:Mtrr APN 13 68564357 missense probably benign
IGL03114:Mtrr APN 13 68564322 nonsense probably null
3-1:Mtrr UTSW 13 68575016 critical splice donor site probably null
H8562:Mtrr UTSW 13 68564377 missense probably damaging 0.97
N/A:Mtrr UTSW 13 68575397 splice site probably benign
R0007:Mtrr UTSW 13 68575330 missense probably benign 0.02
R0741:Mtrr UTSW 13 68579539 splice site probably null
R2140:Mtrr UTSW 13 68568940 missense possibly damaging 0.47
R2513:Mtrr UTSW 13 68566973 nonsense probably null
R4604:Mtrr UTSW 13 68564512 splice site probably null
R5501:Mtrr UTSW 13 68579647 missense probably damaging 1.00
R5658:Mtrr UTSW 13 68568915 missense possibly damaging 0.67
R6694:Mtrr UTSW 13 68564333 missense probably benign
R6979:Mtrr UTSW 13 68570003 critical splice donor site probably null
R7094:Mtrr UTSW 13 68579684 missense possibly damaging 0.83
R7296:Mtrr UTSW 13 68568860 nonsense probably null
R7354:Mtrr UTSW 13 68566207 missense probably damaging 1.00
R7378:Mtrr UTSW 13 68564402 missense probably damaging 1.00
R7546:Mtrr UTSW 13 68582149 unclassified probably benign
R7562:Mtrr UTSW 13 68566217 missense probably damaging 0.96
R7759:Mtrr UTSW 13 68570027 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCAGCAGTAACCAAGTGG -3'
(R):5'- AGTCGCAGCTGGAACATTG -3'

Sequencing Primer
(F):5'- CCAAGTGGCACTGCACAGATG -3'
(R):5'- GCTGGAACATTGCCATAAGTC -3'
Posted On2018-05-21