Incidental Mutation 'R6477:Prss27'
ID516868
Institutional Source Beutler Lab
Gene Symbol Prss27
Ensembl Gene ENSMUSG00000050762
Gene Nameprotease, serine 27
SynonymsMpn, marapsin, Pancreasin, CAPH2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6477 (G1)
Quality Score125.008
Status Validated
Chromosome17
Chromosomal Location24038144-24045954 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24044261 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 83 (T83A)
Ref Sequence ENSEMBL: ENSMUSP00000056483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017090] [ENSMUST00000059482]
Predicted Effect probably benign
Transcript: ENSMUST00000017090
SMART Domains Protein: ENSMUSP00000017090
Gene: ENSMUSG00000016946

DomainStartEndE-ValueType
low complexity region 8 31 N/A INTRINSIC
BTB 44 146 2.76e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000059482
AA Change: T83A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000056483
Gene: ENSMUSG00000050762
AA Change: T83A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Tryp_SPc 37 275 2.29e-92 SMART
low complexity region 283 301 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located within a large protease gene cluster on chromosome 16. It belongs to the group-1 subfamily of serine proteases. The encoded protein is a secreted tryptic serine protease and is expressed mainly in the pancreas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a gene trap allele develop normally and are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,257,630 probably null Het
4933415F23Rik A T 1: 23,101,780 L151Q probably benign Het
Aatk T C 11: 120,018,870 D23G probably benign Het
Abca14 T C 7: 120,325,102 I1659T probably benign Het
Ankdd1a C T 9: 65,502,212 V481M probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Cfap161 T A 7: 83,794,022 R20* probably null Het
Cops7a A T 6: 124,960,176 V184E probably damaging Het
Cpa3 T C 3: 20,239,575 E83G possibly damaging Het
Crls1 C T 2: 132,861,233 S201L probably benign Het
Cyp4f39 C A 17: 32,481,817 S153R probably damaging Het
Ddx54 T A 5: 120,621,778 I410N probably damaging Het
Dido1 T A 2: 180,660,481 T1877S probably benign Het
Dip2c A G 13: 9,623,760 S1079G probably damaging Het
Dnhd1 G A 7: 105,677,886 V681I probably benign Het
Dst A G 1: 34,208,728 probably null Het
Eya2 A G 2: 165,763,761 T362A probably benign Het
Hgs G A 11: 120,469,655 V60M probably damaging Het
Inpp4b A G 8: 81,844,714 probably null Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Kdr C A 5: 75,968,841 A129S probably benign Het
Lhcgr A T 17: 88,742,373 M575K probably damaging Het
Lsamp G T 16: 42,168,165 probably benign Het
Mcm5 T C 8: 75,112,602 V161A probably benign Het
Mmp14 A T 14: 54,437,658 H249L probably damaging Het
Mroh5 A G 15: 73,790,755 S405P probably damaging Het
Mroh9 C A 1: 163,076,304 L46F probably damaging Het
Mtrr A T 13: 68,570,073 H357Q probably damaging Het
Myrf G A 19: 10,228,785 P89L probably benign Het
Mzb1 C T 18: 35,648,258 probably null Het
Naip6 A G 13: 100,316,008 S182P probably damaging Het
Nmur2 A T 11: 56,029,591 F276Y probably damaging Het
Nudt12 G T 17: 59,011,145 S35Y probably benign Het
Olfr1154 A G 2: 87,902,990 S229P probably damaging Het
Olfr572 T A 7: 102,928,378 V250E probably damaging Het
Olfr657 T C 7: 104,635,679 S2P probably benign Het
Osbpl1a T C 18: 12,756,261 I541V probably benign Het
Parp4 A G 14: 56,647,237 K1258E probably benign Het
Plcxd2 C G 16: 45,980,659 K67N probably damaging Het
Pnpla6 A G 8: 3,536,627 T930A probably benign Het
Pomt1 G A 2: 32,248,716 probably null Het
Pramel6 A G 2: 87,510,602 Y426C possibly damaging Het
Rbm27 T A 18: 42,333,318 V915E probably damaging Het
Rnf114 T A 2: 167,503,488 D10E probably benign Het
Sbk1 A G 7: 126,291,178 E121G probably damaging Het
Senp6 A T 9: 80,093,625 R39* probably null Het
Sergef A T 7: 46,633,826 I94N probably benign Het
Slc30a9 C T 5: 67,328,524 R183W probably benign Het
Smurf1 C T 5: 144,889,792 R414H possibly damaging Het
Sptb A T 12: 76,606,392 W1566R probably damaging Het
Tenm2 T C 11: 36,010,507 probably null Het
Tnni1 T C 1: 135,805,566 V42A probably benign Het
Tnxb A G 17: 34,719,539 Y3098C probably damaging Het
Ubald2 T C 11: 116,434,574 F46L probably benign Het
Ubqln5 G A 7: 104,128,258 S453F probably damaging Het
Ubr3 A T 2: 69,979,429 R1248* probably null Het
Utp20 A G 10: 88,768,918 V1705A probably benign Het
Zfp60 G A 7: 27,749,803 R632H probably benign Het
Zfp638 A G 6: 83,965,578 Y957C probably damaging Het
Zfp825 A T 13: 74,480,910 S162R possibly damaging Het
Zfp831 A C 2: 174,704,167 K1355T probably benign Het
Other mutations in Prss27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01574:Prss27 APN 17 24038371 splice site probably benign
IGL01633:Prss27 APN 17 24045676 missense probably damaging 1.00
IGL02096:Prss27 APN 17 24044977 missense possibly damaging 0.94
IGL02318:Prss27 APN 17 24045597 missense probably benign 0.01
IGL02491:Prss27 APN 17 24044255 splice site probably benign
IGL02715:Prss27 APN 17 24044979 missense possibly damaging 0.94
R1582:Prss27 UTSW 17 24044903 missense probably benign 0.11
R5078:Prss27 UTSW 17 24044440 nonsense probably null
R5468:Prss27 UTSW 17 24038313 missense possibly damaging 0.53
R6415:Prss27 UTSW 17 24042908 nonsense probably null
R6450:Prss27 UTSW 17 24045014 nonsense probably null
R7143:Prss27 UTSW 17 24045658 missense probably damaging 1.00
R7285:Prss27 UTSW 17 24045691 missense probably benign 0.01
R7447:Prss27 UTSW 17 24045709 missense probably damaging 1.00
R7825:Prss27 UTSW 17 24042958 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCTCATTGTACCTCATAGG -3'
(R):5'- CTCAAAGATGACCGAGGGATC -3'

Sequencing Primer
(F):5'- GTGTCCCCATCTTACAAATGAGG -3'
(R):5'- CACACAGGAAGGATGTAATTGGTG -3'
Posted On2018-05-21