Incidental Mutation 'R6477:Cyp4f39'
ID516869
Institutional Source Beutler Lab
Gene Symbol Cyp4f39
Ensembl Gene ENSMUSG00000061126
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 39
Synonyms4732474A20Rik
MMRRC Submission
Accession Numbers

Genbank: NM_177307; MGI: 2445210

Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R6477 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location32468462-32492479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 32481817 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 153 (S153R)
Ref Sequence ENSEMBL: ENSMUSP00000003413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003413]
Predicted Effect probably damaging
Transcript: ENSMUST00000003413
AA Change: S153R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000003413
Gene: ENSMUSG00000061126
AA Change: S153R

DomainStartEndE-ValueType
transmembrane domain 18 40 N/A INTRINSIC
Pfam:p450 60 525 5.8e-124 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This gene is part of a cluster of cytochrome P450 genes on chromosome 19 and encodes an enzyme thought to play a role in the 12(R)-lipoxygenase pathway. Mutations in this gene are the cause of ichthyosis lamellar type 3. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,257,630 probably null Het
4933415F23Rik A T 1: 23,101,780 L151Q probably benign Het
Aatk T C 11: 120,018,870 D23G probably benign Het
Abca14 T C 7: 120,325,102 I1659T probably benign Het
Ankdd1a C T 9: 65,502,212 V481M probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Cfap161 T A 7: 83,794,022 R20* probably null Het
Cops7a A T 6: 124,960,176 V184E probably damaging Het
Cpa3 T C 3: 20,239,575 E83G possibly damaging Het
Crls1 C T 2: 132,861,233 S201L probably benign Het
Ddx54 T A 5: 120,621,778 I410N probably damaging Het
Dido1 T A 2: 180,660,481 T1877S probably benign Het
Dip2c A G 13: 9,623,760 S1079G probably damaging Het
Dnhd1 G A 7: 105,677,886 V681I probably benign Het
Dst A G 1: 34,208,728 probably null Het
Eya2 A G 2: 165,763,761 T362A probably benign Het
Hgs G A 11: 120,469,655 V60M probably damaging Het
Inpp4b A G 8: 81,844,714 probably null Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Kdr C A 5: 75,968,841 A129S probably benign Het
Lhcgr A T 17: 88,742,373 M575K probably damaging Het
Lsamp G T 16: 42,168,165 probably benign Het
Mcm5 T C 8: 75,112,602 V161A probably benign Het
Mmp14 A T 14: 54,437,658 H249L probably damaging Het
Mroh5 A G 15: 73,790,755 S405P probably damaging Het
Mroh9 C A 1: 163,076,304 L46F probably damaging Het
Mtrr A T 13: 68,570,073 H357Q probably damaging Het
Myrf G A 19: 10,228,785 P89L probably benign Het
Mzb1 C T 18: 35,648,258 probably null Het
Naip6 A G 13: 100,316,008 S182P probably damaging Het
Nmur2 A T 11: 56,029,591 F276Y probably damaging Het
Nudt12 G T 17: 59,011,145 S35Y probably benign Het
Olfr1154 A G 2: 87,902,990 S229P probably damaging Het
Olfr572 T A 7: 102,928,378 V250E probably damaging Het
Olfr657 T C 7: 104,635,679 S2P probably benign Het
Osbpl1a T C 18: 12,756,261 I541V probably benign Het
Parp4 A G 14: 56,647,237 K1258E probably benign Het
Plcxd2 C G 16: 45,980,659 K67N probably damaging Het
Pnpla6 A G 8: 3,536,627 T930A probably benign Het
Pomt1 G A 2: 32,248,716 probably null Het
Pramel6 A G 2: 87,510,602 Y426C possibly damaging Het
Prss27 A G 17: 24,044,261 T83A probably damaging Het
Rbm27 T A 18: 42,333,318 V915E probably damaging Het
Rnf114 T A 2: 167,503,488 D10E probably benign Het
Sbk1 A G 7: 126,291,178 E121G probably damaging Het
Senp6 A T 9: 80,093,625 R39* probably null Het
Sergef A T 7: 46,633,826 I94N probably benign Het
Slc30a9 C T 5: 67,328,524 R183W probably benign Het
Smurf1 C T 5: 144,889,792 R414H possibly damaging Het
Sptb A T 12: 76,606,392 W1566R probably damaging Het
Tenm2 T C 11: 36,010,507 probably null Het
Tnni1 T C 1: 135,805,566 V42A probably benign Het
Tnxb A G 17: 34,719,539 Y3098C probably damaging Het
Ubald2 T C 11: 116,434,574 F46L probably benign Het
Ubqln5 G A 7: 104,128,258 S453F probably damaging Het
Ubr3 A T 2: 69,979,429 R1248* probably null Het
Utp20 A G 10: 88,768,918 V1705A probably benign Het
Zfp60 G A 7: 27,749,803 R632H probably benign Het
Zfp638 A G 6: 83,965,578 Y957C probably damaging Het
Zfp825 A T 13: 74,480,910 S162R possibly damaging Het
Zfp831 A C 2: 174,704,167 K1355T probably benign Het
Other mutations in Cyp4f39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00789:Cyp4f39 APN 17 32470912 missense probably damaging 1.00
IGL00822:Cyp4f39 APN 17 32470832 missense probably benign 0.03
IGL00857:Cyp4f39 APN 17 32489657 missense probably benign 0.08
IGL01380:Cyp4f39 APN 17 32481858 missense probably damaging 1.00
IGL01532:Cyp4f39 APN 17 32470954 splice site probably benign
IGL01756:Cyp4f39 APN 17 32483441 nonsense probably null
IGL02090:Cyp4f39 APN 17 32470958 splice site probably benign
IGL02477:Cyp4f39 APN 17 32489645 missense probably benign 0.40
IGL02824:Cyp4f39 APN 17 32468685 critical splice donor site probably null
N/A:Cyp4f39 UTSW 17 32468681 missense probably benign 0.03
R0145:Cyp4f39 UTSW 17 32486960 missense possibly damaging 0.92
R0288:Cyp4f39 UTSW 17 32492436 missense probably benign 0.01
R1676:Cyp4f39 UTSW 17 32482202 missense probably benign 0.41
R1677:Cyp4f39 UTSW 17 32492330 missense probably benign 0.30
R1874:Cyp4f39 UTSW 17 32483324 missense probably damaging 1.00
R1920:Cyp4f39 UTSW 17 32483291 missense probably benign 0.00
R2049:Cyp4f39 UTSW 17 32482138 missense probably benign 0.41
R2139:Cyp4f39 UTSW 17 32491189 missense probably benign 0.01
R2212:Cyp4f39 UTSW 17 32487063 missense possibly damaging 0.62
R3416:Cyp4f39 UTSW 17 32489742 missense possibly damaging 0.72
R3417:Cyp4f39 UTSW 17 32489742 missense possibly damaging 0.72
R4486:Cyp4f39 UTSW 17 32483454 missense probably damaging 1.00
R5023:Cyp4f39 UTSW 17 32481104 missense probably damaging 1.00
R5523:Cyp4f39 UTSW 17 32470833 missense probably benign 0.10
R5714:Cyp4f39 UTSW 17 32481825 missense probably damaging 1.00
R6010:Cyp4f39 UTSW 17 32482186 missense probably damaging 0.99
R6312:Cyp4f39 UTSW 17 32483294 missense probably benign 0.00
R6950:Cyp4f39 UTSW 17 32492306 missense probably damaging 1.00
R7228:Cyp4f39 UTSW 17 32491829 missense probably damaging 1.00
R7311:Cyp4f39 UTSW 17 32489655 missense probably damaging 1.00
R7341:Cyp4f39 UTSW 17 32486954 missense probably damaging 1.00
R7345:Cyp4f39 UTSW 17 32486779 missense probably damaging 1.00
R7405:Cyp4f39 UTSW 17 32481815 missense probably benign 0.01
R7522:Cyp4f39 UTSW 17 32486972 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCATAGTGAAACAGGAGCC -3'
(R):5'- GATCCTCACTGCCAATCCAG -3'

Sequencing Primer
(F):5'- GTGAAACAGGAGCCATACTGATTATC -3'
(R):5'- GTCTACACACGGCAAGGGAC -3'
Posted On2018-05-21