Mutagenetix > Incidental Mutation

Incidental Mutation 'R6478:Hmcn1'

516879

Institutional Source

Beutler Lab

Gene Symbol

Hmcn1

Ensembl Gene

ENSMUSG00000066842

Gene Name

hemicentin 1

Synonyms

LOC240793, EG545370

MMRRC Submission

044610-MU

Accession Numbers

Ncbi RefSeq: NM_001024720.3; MGI:2685047

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6478 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

150562524-150993435 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 150664784 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 2925 (R2925W)

Ref Sequence

ENSEMBL: ENSMUSP00000121500 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074783] [ENSMUST00000137197]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000074783
AA Change: R2925W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000074340
Gene: ENSMUSG00000066842
AA Change: R2925W

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
VWA	39	213	3e-1	SMART
IG_like	445	506	1.13e0	SMART
IGc2	532	598	2.32e-8	SMART
IGc2	624	688	1.24e-8	SMART
IGc2	714	779	7.52e-8	SMART
IGc2	805	874	2.19e-9	SMART
IGc2	902	967	5.15e-15	SMART
IGc2	993	1058	1.28e-10	SMART
IGc2	1092	1157	1.69e-10	SMART
IGc2	1183	1247	1.09e-13	SMART
IGc2	1278	1344	6.49e-12	SMART
IGc2	1372	1437	5.2e-11	SMART
IGc2	1465	1531	1.34e-13	SMART
IGc2	1559	1624	6.25e-14	SMART
IGc2	1653	1718	4.06e-13	SMART
IGc2	1746	1811	4.12e-14	SMART
IGc2	1838	1904	5.92e-15	SMART
IGc2	1932	1997	7.69e-14	SMART
IGc2	2023	2089	3.3e-13	SMART
IGc2	2115	2180	5e-13	SMART
IGc2	2208	2275	1.32e-12	SMART
IGc2	2304	2369	2.91e-14	SMART
IGc2	2398	2463	4e-12	SMART
IGc2	2491	2556	1.94e-19	SMART
IGc2	2587	2652	2.54e-14	SMART
IGc2	2686	2751	7.57e-13	SMART
IGc2	2789	2854	4.88e-16	SMART
IGc2	2884	2949	2.7e-9	SMART
IGc2	2976	3041	1.47e-10	SMART
IGc2	3071	3136	2.24e-15	SMART
IGc2	3163	3230	8.83e-14	SMART
IGc2	3258	3325	9.76e-16	SMART
IGc2	3354	3419	1.54e-13	SMART
IGc2	3447	3512	4.35e-13	SMART
IGc2	3540	3605	2e-12	SMART
IGc2	3633	3698	7.69e-14	SMART
IGc2	3724	3789	1.92e-14	SMART
IGc2	3815	3882	2.58e-6	SMART
IGc2	3908	3973	6.4e-11	SMART
IGc2	3999	4064	2.78e-11	SMART
IGc2	4090	4154	1.74e-12	SMART
low complexity region	4155	4160	N/A	INTRINSIC
IGc2	4180	4245	3.35e-14	SMART
IGc2	4271	4334	8.12e-13	SMART
IGc2	4361	4425	1.79e-14	SMART
IGc2	4451	4515	1.06e-11	SMART
TSP1	4531	4583	4.72e-15	SMART
TSP1	4588	4640	2.39e-16	SMART
TSP1	4645	4697	1.67e-15	SMART
TSP1	4702	4754	2.2e-15	SMART
TSP1	4759	4811	2.77e-12	SMART
TSP1	4816	4868	2.67e-14	SMART
Pfam:G2F	4869	5051	1.5e-57	PFAM
EGF_CA	5106	5145	4.38e-11	SMART
EGF_CA	5146	5190	4.49e-8	SMART
EGF_CA	5191	5228	2.38e-12	SMART
EGF_CA	5229	5270	6.8e-8	SMART
EGF_CA	5271	5313	3.51e-10	SMART
EGF_CA	5314	5354	4.32e-10	SMART
low complexity region	5384	5400	N/A	INTRINSIC
low complexity region	5401	5412	N/A	INTRINSIC
EGF_CA	5431	5470	2.78e-13	SMART
EGF	5474	5516	1.44e1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000137197
AA Change: R2925W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000121500
Gene: ENSMUSG00000066842
AA Change: R2925W

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
VWA	39	213	3e-1	SMART
IG_like	445	506	1.13e0	SMART
IGc2	532	598	2.32e-8	SMART
IGc2	624	688	1.24e-8	SMART
IGc2	714	779	7.52e-8	SMART
IGc2	805	874	2.19e-9	SMART
IGc2	902	967	5.15e-15	SMART
IGc2	993	1058	1.28e-10	SMART
IGc2	1092	1157	1.69e-10	SMART
IGc2	1183	1247	1.09e-13	SMART
IGc2	1278	1344	6.49e-12	SMART
IGc2	1372	1437	5.2e-11	SMART
IGc2	1465	1531	1.34e-13	SMART
IGc2	1559	1624	6.25e-14	SMART
IGc2	1653	1718	4.06e-13	SMART
IGc2	1746	1811	4.12e-14	SMART
IGc2	1838	1904	5.92e-15	SMART
IGc2	1932	1997	7.69e-14	SMART
IGc2	2023	2089	3.3e-13	SMART
IGc2	2115	2180	5e-13	SMART
IGc2	2208	2275	1.32e-12	SMART
IGc2	2304	2369	2.91e-14	SMART
IGc2	2398	2463	4e-12	SMART
IGc2	2491	2556	1.94e-19	SMART
IGc2	2587	2652	2.54e-14	SMART
IGc2	2686	2751	7.57e-13	SMART
IGc2	2789	2854	4.88e-16	SMART
IGc2	2884	2949	2.7e-9	SMART
IGc2	2976	3041	1.47e-10	SMART
IGc2	3071	3136	2.24e-15	SMART
IGc2	3163	3230	8.83e-14	SMART
IGc2	3258	3325	9.76e-16	SMART
IGc2	3354	3419	1.54e-13	SMART
IGc2	3447	3512	4.35e-13	SMART
IGc2	3540	3605	2e-12	SMART
IGc2	3633	3698	7.69e-14	SMART
IGc2	3724	3789	1.92e-14	SMART
IGc2	3815	3882	2.58e-6	SMART
IGc2	3908	3973	6.4e-11	SMART
IGc2	3999	4064	2.78e-11	SMART
IGc2	4090	4154	1.74e-12	SMART
low complexity region	4155	4160	N/A	INTRINSIC
IGc2	4180	4245	3.35e-14	SMART
IGc2	4271	4334	8.12e-13	SMART
IGc2	4361	4425	1.79e-14	SMART
IGc2	4451	4515	1.06e-11	SMART
TSP1	4531	4583	4.72e-15	SMART
TSP1	4588	4640	2.39e-16	SMART
TSP1	4645	4697	1.67e-15	SMART
TSP1	4702	4754	2.2e-15	SMART
TSP1	4759	4811	2.77e-12	SMART
TSP1	4816	4868	2.67e-14	SMART
PDB:1GL4\|A	4869	5082	3e-6	PDB
SCOP:d1gl4a1	4869	5082	3e-79	SMART
EGF_CA	5106	5145	4.38e-11	SMART
EGF_CA	5146	5190	4.49e-8	SMART
EGF_CA	5191	5228	2.38e-12	SMART
EGF_CA	5229	5270	6.8e-8	SMART
EGF_CA	5271	5313	3.51e-10	SMART
EGF_CA	5314	5353	2.78e-13	SMART
EGF	5357	5399	1.44e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177239

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177268

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.3%

Validation Efficiency

95% (75/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large extracellular member of the immunoglobulin superfamily. A similar protein in C. elegans forms long, fine tracks at specific extracellular sites that are involved in many processes such as stabilization of the germline syncytium, anchorage of mechanosensory neurons to the epidermis, and organization of hemidesmosomes in the epidermis. Mutations in this gene may be associated with age-related macular degeneration. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	A	G	14: 49,773,332	V306A	possibly damaging	Het
9530053A07Rik	C	G	7: 28,155,373	P1808R	probably damaging	Het
Aatk	T	A	11: 120,010,991	S803C	probably benign	Het
Abcc9	C	T	6: 142,679,308	A454T	probably damaging	Het
Abr	T	C	11: 76,452,332	E565G	probably damaging	Het
Adam33	C	A	2: 131,051,346	R753L	probably benign	Het
Adgre1	A	G	17: 57,401,955	T49A	possibly damaging	Het
AI314180	A	T	4: 58,810,785	I1524N	probably damaging	Het
Ankra2	A	T	13: 98,268,442	H153L	probably damaging	Het
Ankrd26	T	G	6: 118,511,638	E1353D	probably benign	Het
Ankrd52	T	G	10: 128,379,331		probably null	Het
Arhgef10l	T	A	4: 140,542,757	T619S	possibly damaging	Het
Asgr1	T	C	11: 70,056,894	V130A	possibly damaging	Het
Atg10	C	A	13: 90,937,347	C161F	probably damaging	Het
Atm	A	T	9: 53,490,254	N1438K	probably damaging	Het
BC107364	T	A	3: 96,436,006		probably null	Het
Bcar3	G	T	3: 122,426,576	A41S	probably benign	Het
Btbd6	A	G	12: 112,977,312		probably benign	Het
Cchcr1	A	G	17: 35,524,703	T318A	possibly damaging	Het
Celsr1	A	T	15: 85,925,518	I2221N	probably damaging	Het
Cept1	C	T	3: 106,533,445	W48*	probably null	Het
Cfap161	T	A	7: 83,793,276	I85L	probably benign	Het
Clasp1	A	T	1: 118,512,180	R640*	probably null	Het
Col5a1	T	A	2: 27,952,436	I441N	unknown	Het
Col9a1	C	A	1: 24,185,405	L223I	unknown	Het
Dnah2	T	C	11: 69,516,010	D223G	probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Dpy19l1	A	T	9: 24,450,696	M129K	possibly damaging	Het
Fcrl1	C	A	3: 87,389,639	H318Q	probably benign	Het
Fer1l5	A	G	1: 36,402,531	N609S	probably damaging	Het
Fkbp4	C	T	6: 128,433,231	E256K	probably damaging	Het
Fsip2	A	G	2: 82,990,086	T5388A	possibly damaging	Het
Glrx	G	A	13: 75,847,299		probably null	Het
Gm6614	A	T	6: 141,993,642	N208K	possibly damaging	Het
Gm7356	A	T	17: 14,001,464	M101K	probably damaging	Het
Gstp2	A	T	19: 4,040,499	I162N	probably benign	Het
Hectd3	A	C	4: 116,999,586	K443N	probably damaging	Het
Hspa1a	G	T	17: 34,970,306	N540K	probably damaging	Het
Ints6	A	T	14: 62,700,786	M649K	probably benign	Het
Katnb1	T	C	8: 95,095,456	V270A	possibly damaging	Het
Kctd3	A	G	1: 188,972,364	S737P	probably benign	Het
Klra10	T	C	6: 130,272,544		probably null	Het
Lmtk3	A	G	7: 45,798,589	D1353G	unknown	Het
Lrrk1	A	G	7: 66,262,733	V1693A	probably damaging	Het
Mpnd	A	T	17: 56,009,575	I85F	probably damaging	Het
Myo3b	A	G	2: 70,348,960	T1173A	probably benign	Het
Myof	G	A	19: 37,903,831	P1158L	probably damaging	Het
Naip2	A	C	13: 100,162,041	S496A	probably benign	Het
Ncor2	A	G	5: 125,110,005		probably benign	Het
Npepps	C	T	11: 97,258,273		probably null	Het
Olfr1247	T	G	2: 89,609,446	I219L	probably damaging	Het
Opn5	T	A	17: 42,580,749	I266F	probably benign	Het
P2rx4	A	G	5: 122,707,700	D16G	probably damaging	Het
Padi2	G	T	4: 140,917,637	V61L	probably benign	Het
Pkd1l1	G	A	11: 8,863,911	T1480I	probably benign	Het
Plcb1	T	C	2: 135,335,451	S568P	probably damaging	Het
Rassf10	A	G	7: 112,955,707	E505G	probably damaging	Het
Rcan2	A	G	17: 43,836,334	E21G	probably benign	Het
Rhob	G	T	12: 8,499,585	C16*	probably null	Het
Ryr3	T	C	2: 112,660,068	N3807S	probably damaging	Het
Sass6	T	A	3: 116,621,397	N519K	probably benign	Het
Smad9	A	T	3: 54,782,443	D28V	probably damaging	Het
Tepp	A	T	8: 95,321,266		probably null	Het
Tex14	G	T	11: 87,514,373	G704C	probably benign	Het
Tmc3	A	G	7: 83,622,316	N892S	probably benign	Het
Tnfaip2	T	A	12: 111,445,663	L166Q	probably damaging	Het
Triml2	A	G	8: 43,185,128		probably null	Het
Trio	A	G	15: 27,856,107	V666A	probably benign	Het
Tshz2	G	T	2: 169,884,664	L393F	probably damaging	Het
Ttn	T	G	2: 76,841,771		probably benign	Het
Tubb5	A	G	17: 35,835,842	Y159H	probably damaging	Het
Umodl1	A	G	17: 30,959,155	Y35C	probably damaging	Het
Utp4	T	C	8: 106,904,446		probably null	Het
Vmn1r60	A	T	7: 5,544,865	C79S	probably damaging	Het
Wnt5b	T	C	6: 119,433,790	T230A	probably damaging	Het
Zfp618	A	T	4: 63,132,706	I575F	probably damaging	Het
Zmym6	G	T	4: 127,123,383	V894L	possibly damaging	Het
Zpbp	T	C	11: 11,462,318		probably benign	Het

Other mutations in Hmcn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Hmcn1	APN	1	150677278	missense	probably benign
IGL00571:Hmcn1	APN	1	150638999	missense	probably benign	0.05
IGL00726:Hmcn1	APN	1	150806366	critical splice donor site	probably null
IGL00802:Hmcn1	APN	1	150664936	missense	probably benign	0.19
IGL00824:Hmcn1	APN	1	150656734	missense	probably damaging	1.00
IGL00834:Hmcn1	APN	1	150630340	missense	probably benign	0.00
IGL00843:Hmcn1	APN	1	150610713	missense	possibly damaging	0.95
IGL00845:Hmcn1	APN	1	150605006	missense	probably damaging	0.98
IGL00851:Hmcn1	APN	1	150582301	missense	probably benign	0.02
IGL00909:Hmcn1	APN	1	150638869	missense	probably benign	0.12
IGL01074:Hmcn1	APN	1	150627033	missense	possibly damaging	0.82
IGL01112:Hmcn1	APN	1	150632552	splice site	probably benign
IGL01304:Hmcn1	APN	1	150622924	missense	probably damaging	0.99
IGL01307:Hmcn1	APN	1	150745001	missense	possibly damaging	0.84
IGL01318:Hmcn1	APN	1	150719240	missense	probably damaging	1.00
IGL01403:Hmcn1	APN	1	150593097	missense	probably damaging	1.00
IGL01417:Hmcn1	APN	1	150859239	missense	probably damaging	1.00
IGL01503:Hmcn1	APN	1	150605072	missense	probably benign	0.38
IGL01509:Hmcn1	APN	1	150609631	missense	probably damaging	1.00
IGL01550:Hmcn1	APN	1	150598397	missense	probably damaging	1.00
IGL01601:Hmcn1	APN	1	150627413	missense	probably benign	0.01
IGL01617:Hmcn1	APN	1	150672032	missense	probably benign	0.05
IGL01636:Hmcn1	APN	1	150580233	missense	probably damaging	1.00
IGL01662:Hmcn1	APN	1	150737299	missense	possibly damaging	0.46
IGL01693:Hmcn1	APN	1	150583280	missense	probably damaging	1.00
IGL01723:Hmcn1	APN	1	150744960	missense	probably benign	0.01
IGL01776:Hmcn1	APN	1	150672038	missense	possibly damaging	0.70
IGL01783:Hmcn1	APN	1	150615300	missense	possibly damaging	0.60
IGL01789:Hmcn1	APN	1	150690601	missense	probably damaging	1.00
IGL01900:Hmcn1	APN	1	150742260	splice site	probably benign
IGL01906:Hmcn1	APN	1	150667887	missense	probably benign	0.01
IGL01947:Hmcn1	APN	1	150732892	missense	possibly damaging	0.93
IGL01958:Hmcn1	APN	1	150603871	missense	probably benign	0.01
IGL02002:Hmcn1	APN	1	150615298	missense	probably damaging	1.00
IGL02058:Hmcn1	APN	1	150704181	missense	probably benign	0.02
IGL02115:Hmcn1	APN	1	150630728	missense	probably damaging	1.00
IGL02127:Hmcn1	APN	1	150722607	missense	probably benign
IGL02155:Hmcn1	APN	1	150563598	missense	probably damaging	1.00
IGL02222:Hmcn1	APN	1	150806401	missense	probably benign	0.05
IGL02293:Hmcn1	APN	1	150664915	missense	probably damaging	0.97
IGL02398:Hmcn1	APN	1	150802897	missense	possibly damaging	0.78
IGL02420:Hmcn1	APN	1	150722424	missense	probably damaging	1.00
IGL02553:Hmcn1	APN	1	150993023	missense	probably benign	0.12
IGL02561:Hmcn1	APN	1	150809726	missense	probably benign	0.32
IGL02569:Hmcn1	APN	1	150697493	missense	probably benign	0.01
IGL02607:Hmcn1	APN	1	150744995	missense	possibly damaging	0.88
IGL02676:Hmcn1	APN	1	150619009	missense	probably benign	0.01
IGL02725:Hmcn1	APN	1	150604903	missense	possibly damaging	0.92
IGL02726:Hmcn1	APN	1	150656694	nonsense	probably null
IGL02735:Hmcn1	APN	1	150646832	missense	probably benign	0.02
IGL02737:Hmcn1	APN	1	150563828	missense	probably damaging	1.00
IGL02892:Hmcn1	APN	1	150675974	critical splice donor site	probably null
IGL02927:Hmcn1	APN	1	150577278	missense	probably damaging	1.00
IGL02931:Hmcn1	APN	1	150657207	missense	probably benign	0.37
IGL02936:Hmcn1	APN	1	150697522	missense	probably damaging	0.98
IGL02985:Hmcn1	APN	1	150671917	missense	probably damaging	1.00
IGL03027:Hmcn1	APN	1	150808539	missense	probably benign
IGL03195:Hmcn1	APN	1	150802909	missense	probably benign	0.06
IGL03217:Hmcn1	APN	1	150743667	missense	possibly damaging	0.58
IGL03232:Hmcn1	APN	1	150770352	splice site	probably benign
IGL03268:Hmcn1	APN	1	150772510	missense	probably damaging	1.00
IGL03271:Hmcn1	APN	1	150598424	missense	possibly damaging	0.92
IGL03304:Hmcn1	APN	1	150630231	missense	probably damaging	0.97
IGL03329:Hmcn1	APN	1	150732910	missense	probably damaging	1.00
IGL03339:Hmcn1	APN	1	150701969	missense	probably benign	0.04
IGL03368:Hmcn1	APN	1	150663872	missense	probably damaging	1.00
Backbone	UTSW	1	150622994	missense	probably benign	0.09
Cambrian	UTSW	1	150732846	missense	probably damaging	1.00
chordate	UTSW	1	150587015	missense	probably benign	0.00
Justamere	UTSW	1	150588257	missense	probably damaging	1.00
Lancelet	UTSW	1	150675540	missense	probably benign	0.00
notochord	UTSW	1	150770293	missense	probably benign	0.00
wippoorwill	UTSW	1	150732946	missense	probably damaging	1.00
BB004:Hmcn1	UTSW	1	150609775	missense	probably damaging	1.00
BB014:Hmcn1	UTSW	1	150609775	missense	probably damaging	1.00
IGL02991:Hmcn1	UTSW	1	150738658	missense	possibly damaging	0.56
P0017:Hmcn1	UTSW	1	150720689	missense	possibly damaging	0.49
PIT1430001:Hmcn1	UTSW	1	150808737	missense	probably benign	0.00
PIT4514001:Hmcn1	UTSW	1	150669487	missense	possibly damaging	0.93
R0006:Hmcn1	UTSW	1	150808676	missense	probably damaging	0.99
R0018:Hmcn1	UTSW	1	150652551	missense	probably benign	0.16
R0052:Hmcn1	UTSW	1	150677406	missense	probably damaging	1.00
R0107:Hmcn1	UTSW	1	150587015	missense	probably benign	0.00
R0115:Hmcn1	UTSW	1	150808647	missense	possibly damaging	0.88
R0149:Hmcn1	UTSW	1	150677324	missense	probably benign	0.00
R0152:Hmcn1	UTSW	1	150663879	missense	probably benign	0.01
R0381:Hmcn1	UTSW	1	150603811	missense	probably damaging	1.00
R0398:Hmcn1	UTSW	1	150798814	missense	possibly damaging	0.83
R0414:Hmcn1	UTSW	1	150715822	missense	possibly damaging	0.72
R0494:Hmcn1	UTSW	1	150732792	splice site	probably benign
R0503:Hmcn1	UTSW	1	150859252	missense	probably damaging	1.00
R0504:Hmcn1	UTSW	1	150876419	splice site	probably benign
R0506:Hmcn1	UTSW	1	150742341	missense	possibly damaging	0.69
R0554:Hmcn1	UTSW	1	150719117	missense	probably benign	0.34
R0576:Hmcn1	UTSW	1	150650017	nonsense	probably null
R0599:Hmcn1	UTSW	1	150609801	missense	possibly damaging	0.91
R0605:Hmcn1	UTSW	1	150657376	critical splice donor site	probably null
R0607:Hmcn1	UTSW	1	150638900	missense	probably benign	0.01
R0620:Hmcn1	UTSW	1	150594016	missense	probably benign	0.04
R0626:Hmcn1	UTSW	1	150798719	splice site	probably null
R0699:Hmcn1	UTSW	1	150819410	missense	probably damaging	1.00
R0765:Hmcn1	UTSW	1	150808787	missense	probably damaging	1.00
R0782:Hmcn1	UTSW	1	150753665	missense	possibly damaging	0.82
R0783:Hmcn1	UTSW	1	150650073	missense	probably damaging	1.00
R0841:Hmcn1	UTSW	1	150679607	splice site	probably null
R0975:Hmcn1	UTSW	1	150577377	missense	probably benign	0.00
R1070:Hmcn1	UTSW	1	150689590	missense	probably damaging	0.98
R1118:Hmcn1	UTSW	1	150618928	missense	possibly damaging	0.56
R1119:Hmcn1	UTSW	1	150618928	missense	possibly damaging	0.56
R1145:Hmcn1	UTSW	1	150679607	splice site	probably null
R1145:Hmcn1	UTSW	1	150679607	splice site	probably null
R1233:Hmcn1	UTSW	1	150749026	missense	probably benign
R1234:Hmcn1	UTSW	1	150753654	nonsense	probably null
R1291:Hmcn1	UTSW	1	150748191	missense	probably damaging	1.00
R1334:Hmcn1	UTSW	1	150586468	missense	possibly damaging	0.73
R1372:Hmcn1	UTSW	1	150680715	missense	probably benign	0.22
R1424:Hmcn1	UTSW	1	150646794	missense	probably benign	0.00
R1450:Hmcn1	UTSW	1	150652506	splice site	probably benign
R1458:Hmcn1	UTSW	1	150609700	missense	probably damaging	1.00
R1467:Hmcn1	UTSW	1	150689590	missense	probably damaging	0.98
R1467:Hmcn1	UTSW	1	150689590	missense	probably damaging	0.98
R1473:Hmcn1	UTSW	1	150772552	missense	probably benign	0.03
R1517:Hmcn1	UTSW	1	150669421	missense	probably damaging	1.00
R1527:Hmcn1	UTSW	1	150773803	missense	probably benign	0.00
R1557:Hmcn1	UTSW	1	150734532	missense	possibly damaging	0.86
R1576:Hmcn1	UTSW	1	150657241	missense	possibly damaging	0.77
R1617:Hmcn1	UTSW	1	150745027	missense	probably damaging	0.98
R1635:Hmcn1	UTSW	1	150669558	missense	probably benign	0.00
R1655:Hmcn1	UTSW	1	150630333	missense	probably benign	0.03
R1698:Hmcn1	UTSW	1	150565369	nonsense	probably null
R1710:Hmcn1	UTSW	1	150675984	missense	probably damaging	1.00
R1717:Hmcn1	UTSW	1	150859186	missense	probably damaging	1.00
R1753:Hmcn1	UTSW	1	150586468	missense	possibly damaging	0.73
R1756:Hmcn1	UTSW	1	150599030	missense	probably damaging	1.00
R1772:Hmcn1	UTSW	1	150563568	missense	probably damaging	0.99
R1793:Hmcn1	UTSW	1	150749083	missense	probably benign	0.01
R1794:Hmcn1	UTSW	1	150598285	missense	probably benign	0.00
R1794:Hmcn1	UTSW	1	150627152	missense	probably damaging	0.98
R1856:Hmcn1	UTSW	1	150721664	missense	probably benign	0.02
R1859:Hmcn1	UTSW	1	150657193	missense	probably damaging	1.00
R1862:Hmcn1	UTSW	1	150638900	missense	probably benign	0.01
R1865:Hmcn1	UTSW	1	150603812	missense	probably damaging	1.00
R1874:Hmcn1	UTSW	1	150720695	missense	probably damaging	1.00
R1880:Hmcn1	UTSW	1	150638900	missense	probably benign	0.01
R1881:Hmcn1	UTSW	1	150638900	missense	probably benign	0.01
R1886:Hmcn1	UTSW	1	150577295	missense	probably benign	0.02
R1888:Hmcn1	UTSW	1	150819500	missense	possibly damaging	0.82
R1888:Hmcn1	UTSW	1	150819500	missense	possibly damaging	0.82
R1899:Hmcn1	UTSW	1	150657451	missense	probably damaging	1.00
R1905:Hmcn1	UTSW	1	150992855	missense	probably damaging	1.00
R1912:Hmcn1	UTSW	1	150604882	missense	probably benign	0.28
R1959:Hmcn1	UTSW	1	150649676	missense	probably benign	0.00
R1960:Hmcn1	UTSW	1	150675991	missense	probably benign	0.00
R1960:Hmcn1	UTSW	1	150677376	missense	possibly damaging	0.72
R2001:Hmcn1	UTSW	1	150738613	missense	possibly damaging	0.81
R2011:Hmcn1	UTSW	1	150677334	missense	probably benign	0.01
R2075:Hmcn1	UTSW	1	150577323	missense	possibly damaging	0.86
R2136:Hmcn1	UTSW	1	150633659	missense	probably damaging	1.00
R2192:Hmcn1	UTSW	1	150715815	missense	probably damaging	0.97
R2267:Hmcn1	UTSW	1	150599010	missense	probably benign	0.00
R2268:Hmcn1	UTSW	1	150624598	splice site	probably benign
R2303:Hmcn1	UTSW	1	150704226	missense	probably damaging	1.00
R2330:Hmcn1	UTSW	1	150652678	splice site	probably benign
R2338:Hmcn1	UTSW	1	150622934	missense	possibly damaging	0.89
R2380:Hmcn1	UTSW	1	150565384	missense	probably benign	0.01
R2405:Hmcn1	UTSW	1	150860341	missense	probably damaging	1.00
R2443:Hmcn1	UTSW	1	150599032	missense	probably benign	0.01
R2496:Hmcn1	UTSW	1	150615221	missense	probably benign	0.01
R2504:Hmcn1	UTSW	1	150686867	nonsense	probably null
R2519:Hmcn1	UTSW	1	150773820	nonsense	probably null
R2520:Hmcn1	UTSW	1	150743647	missense	possibly damaging	0.72
R2679:Hmcn1	UTSW	1	150652575	missense	possibly damaging	0.67
R2831:Hmcn1	UTSW	1	150630652	critical splice donor site	probably null
R2847:Hmcn1	UTSW	1	150563599	nonsense	probably null
R2849:Hmcn1	UTSW	1	150563599	nonsense	probably null
R2869:Hmcn1	UTSW	1	150738716	missense	possibly damaging	0.95
R2869:Hmcn1	UTSW	1	150738716	missense	possibly damaging	0.95
R2871:Hmcn1	UTSW	1	150738716	missense	possibly damaging	0.95
R2871:Hmcn1	UTSW	1	150738716	missense	possibly damaging	0.95
R2872:Hmcn1	UTSW	1	150738716	missense	possibly damaging	0.95
R2872:Hmcn1	UTSW	1	150738716	missense	possibly damaging	0.95
R2873:Hmcn1	UTSW	1	150738716	missense	possibly damaging	0.95
R2897:Hmcn1	UTSW	1	150802873	missense	probably damaging	1.00
R2905:Hmcn1	UTSW	1	150749035	missense	probably damaging	1.00
R3498:Hmcn1	UTSW	1	150605102	missense	probably damaging	0.98
R3499:Hmcn1	UTSW	1	150605102	missense	probably damaging	0.98
R3724:Hmcn1	UTSW	1	150689518	missense	possibly damaging	0.82
R3765:Hmcn1	UTSW	1	150745025	missense	possibly damaging	0.72
R3778:Hmcn1	UTSW	1	150802824	missense	possibly damaging	0.95
R3790:Hmcn1	UTSW	1	150622994	missense	probably benign	0.09
R3796:Hmcn1	UTSW	1	150586418	missense	probably damaging	1.00
R3811:Hmcn1	UTSW	1	150649577	critical splice donor site	probably null
R3825:Hmcn1	UTSW	1	150586965	missense	probably benign	0.28
R3890:Hmcn1	UTSW	1	150635195	missense	probably damaging	1.00
R3891:Hmcn1	UTSW	1	150635195	missense	probably damaging	1.00
R3892:Hmcn1	UTSW	1	150635195	missense	probably damaging	1.00
R3918:Hmcn1	UTSW	1	150690610	missense	probably benign	0.00
R3964:Hmcn1	UTSW	1	150573569	missense	probably benign	0.00
R4005:Hmcn1	UTSW	1	150722453	missense	possibly damaging	0.88
R4026:Hmcn1	UTSW	1	150722369	missense	probably benign	0.03
R4037:Hmcn1	UTSW	1	150772502	missense	probably benign	0.00
R4088:Hmcn1	UTSW	1	150703216	missense	possibly damaging	0.58
R4096:Hmcn1	UTSW	1	150658508	missense	probably benign	0.20
R4169:Hmcn1	UTSW	1	150595999	splice site	probably null
R4441:Hmcn1	UTSW	1	150657459	missense	probably null
R4493:Hmcn1	UTSW	1	150701899	missense	probably damaging	1.00
R4501:Hmcn1	UTSW	1	150633666	missense	probably damaging	1.00
R4535:Hmcn1	UTSW	1	150563780	missense	probably damaging	0.99
R4576:Hmcn1	UTSW	1	150734487	missense	probably benign
R4601:Hmcn1	UTSW	1	150738645	missense	probably damaging	0.99
R4627:Hmcn1	UTSW	1	150595894	missense	probably benign	0.11
R4647:Hmcn1	UTSW	1	150675511	critical splice donor site	probably null
R4657:Hmcn1	UTSW	1	150624550	missense	probably damaging	1.00
R4717:Hmcn1	UTSW	1	150619065	missense	probably benign	0.00
R4721:Hmcn1	UTSW	1	150772571	splice site	probably null
R4724:Hmcn1	UTSW	1	150694833	splice site	probably null
R4737:Hmcn1	UTSW	1	150689595	missense	possibly damaging	0.90
R4744:Hmcn1	UTSW	1	150577612	missense	probably damaging	1.00
R4795:Hmcn1	UTSW	1	150753611	missense	probably benign	0.00
R4796:Hmcn1	UTSW	1	150753611	missense	probably benign	0.00
R4871:Hmcn1	UTSW	1	150593085	missense	probably benign	0.02
R4895:Hmcn1	UTSW	1	150677379	missense	probably benign	0.00
R4934:Hmcn1	UTSW	1	150722535	missense	probably damaging	1.00
R4953:Hmcn1	UTSW	1	150876360	intron	probably benign
R4968:Hmcn1	UTSW	1	150657470	missense	possibly damaging	0.67
R4974:Hmcn1	UTSW	1	150819449	missense	probably benign	0.01
R5024:Hmcn1	UTSW	1	150680688	missense	possibly damaging	0.65
R5031:Hmcn1	UTSW	1	150588257	missense	probably damaging	1.00
R5093:Hmcn1	UTSW	1	150737256	missense	probably benign	0.14
R5096:Hmcn1	UTSW	1	150610669	missense	probably damaging	1.00
R5185:Hmcn1	UTSW	1	150656741	missense	probably benign	0.03
R5228:Hmcn1	UTSW	1	150646701	missense	probably benign	0.00
R5260:Hmcn1	UTSW	1	150595861	missense	possibly damaging	0.65
R5264:Hmcn1	UTSW	1	150679514	missense	probably benign	0.01
R5282:Hmcn1	UTSW	1	150582296	missense	probably damaging	1.00
R5334:Hmcn1	UTSW	1	150755372	missense	probably damaging	0.99
R5346:Hmcn1	UTSW	1	150623244	missense	probably damaging	1.00
R5423:Hmcn1	UTSW	1	150701972	missense	probably damaging	1.00
R5484:Hmcn1	UTSW	1	150675540	missense	probably benign	0.00
R5491:Hmcn1	UTSW	1	150609825	splice site	probably null
R5531:Hmcn1	UTSW	1	150743788	missense	probably damaging	1.00
R5536:Hmcn1	UTSW	1	150755291	missense	probably benign	0.01
R5547:Hmcn1	UTSW	1	150737506	missense	possibly damaging	0.64
R5580:Hmcn1	UTSW	1	150577539	missense	probably benign	0.43
R5626:Hmcn1	UTSW	1	150656567	missense	probably damaging	1.00
R5657:Hmcn1	UTSW	1	150658562	missense	probably benign	0.02
R5677:Hmcn1	UTSW	1	150609778	missense	probably benign	0.00
R5718:Hmcn1	UTSW	1	150609666	missense	probably damaging	1.00
R5718:Hmcn1	UTSW	1	150690600	nonsense	probably null
R5723:Hmcn1	UTSW	1	150694849	missense	possibly damaging	0.95
R5739:Hmcn1	UTSW	1	150758474	splice site	probably null
R5739:Hmcn1	UTSW	1	150808697	missense	probably benign	0.45
R5751:Hmcn1	UTSW	1	150573554	missense	probably damaging	1.00
R5772:Hmcn1	UTSW	1	150694878	missense	possibly damaging	0.47
R5804:Hmcn1	UTSW	1	150674347	nonsense	probably null
R5809:Hmcn1	UTSW	1	150649607	missense	probably damaging	1.00
R5817:Hmcn1	UTSW	1	150737524	missense	possibly damaging	0.77
R5824:Hmcn1	UTSW	1	150993023	missense	probably benign	0.12
R5881:Hmcn1	UTSW	1	150630327	missense	probably damaging	0.99
R5928:Hmcn1	UTSW	1	150598897	missense	possibly damaging	0.64
R5929:Hmcn1	UTSW	1	150577296	nonsense	probably null
R5940:Hmcn1	UTSW	1	150657222	missense	probably benign	0.41
R5973:Hmcn1	UTSW	1	150563817	missense	probably damaging	1.00
R5997:Hmcn1	UTSW	1	150704173	missense	possibly damaging	0.74
R6027:Hmcn1	UTSW	1	150802895	missense	possibly damaging	0.79
R6029:Hmcn1	UTSW	1	150632437	missense	probably benign	0.13
R6056:Hmcn1	UTSW	1	150663909	missense	probably damaging	1.00
R6065:Hmcn1	UTSW	1	150770330	missense	probably benign	0.06
R6083:Hmcn1	UTSW	1	150755293	missense	probably damaging	1.00
R6083:Hmcn1	UTSW	1	150755294	missense	probably damaging	1.00
R6108:Hmcn1	UTSW	1	150631227	missense	possibly damaging	0.95
R6112:Hmcn1	UTSW	1	150618936	missense	probably damaging	1.00
R6140:Hmcn1	UTSW	1	150732846	missense	probably damaging	1.00
R6144:Hmcn1	UTSW	1	150722424	missense	probably damaging	1.00
R6152:Hmcn1	UTSW	1	150565425	missense	probably damaging	1.00
R6174:Hmcn1	UTSW	1	150646784	missense	probably benign	0.06
R6185:Hmcn1	UTSW	1	150615438	splice site	probably null
R6187:Hmcn1	UTSW	1	150630728	missense	probably damaging	1.00
R6276:Hmcn1	UTSW	1	150738681	missense	possibly damaging	0.69
R6278:Hmcn1	UTSW	1	150697419	critical splice donor site	probably null
R6427:Hmcn1	UTSW	1	150697476	missense	possibly damaging	0.85
R6431:Hmcn1	UTSW	1	150744960	missense	probably benign	0.01
R6441:Hmcn1	UTSW	1	150703216	missense	possibly damaging	0.58
R6451:Hmcn1	UTSW	1	150992919	missense	probably damaging	1.00
R6479:Hmcn1	UTSW	1	150677302	nonsense	probably null
R6490:Hmcn1	UTSW	1	150583278	missense	probably benign	0.00
R6525:Hmcn1	UTSW	1	150697566	missense	probably damaging	1.00
R6571:Hmcn1	UTSW	1	150615438	splice site	probably null
R6612:Hmcn1	UTSW	1	150595118	critical splice donor site	probably null
R6616:Hmcn1	UTSW	1	150723257	critical splice donor site	probably null
R6617:Hmcn1	UTSW	1	150743796	missense	probably benign	0.01
R6623:Hmcn1	UTSW	1	150758306	missense	probably benign
R6687:Hmcn1	UTSW	1	150745033	missense	probably benign	0.30
R6714:Hmcn1	UTSW	1	150704175	missense	probably damaging	0.97
R6751:Hmcn1	UTSW	1	150734518	missense	probably damaging	0.98
R6831:Hmcn1	UTSW	1	150770293	missense	probably benign	0.00
R6971:Hmcn1	UTSW	1	150993051	start codon destroyed	probably benign	0.00
R7048:Hmcn1	UTSW	1	150599653	critical splice acceptor site	probably null
R7058:Hmcn1	UTSW	1	150773890	missense	probably benign	0.43
R7071:Hmcn1	UTSW	1	150604102	missense	probably damaging	1.00
R7078:Hmcn1	UTSW	1	150860367	missense	probably damaging	1.00
R7092:Hmcn1	UTSW	1	150604246	missense	probably damaging	1.00
R7120:Hmcn1	UTSW	1	150700541	missense	probably damaging	0.98
R7129:Hmcn1	UTSW	1	150577210	splice site	probably null
R7144:Hmcn1	UTSW	1	150663873	missense	probably damaging	1.00
R7148:Hmcn1	UTSW	1	150686854	missense	probably benign	0.00
R7162:Hmcn1	UTSW	1	150748993	missense	probably benign	0.18
R7172:Hmcn1	UTSW	1	150753699	missense	possibly damaging	0.92
R7193:Hmcn1	UTSW	1	150649580	missense	probably null	1.00
R7231:Hmcn1	UTSW	1	150638876	missense	probably benign	0.00
R7237:Hmcn1	UTSW	1	150722643	missense	probably damaging	0.98
R7258:Hmcn1	UTSW	1	150715823	missense	probably benign	0.12
R7286:Hmcn1	UTSW	1	150582337	missense	probably damaging	0.98
R7289:Hmcn1	UTSW	1	150683715	missense	possibly damaging	0.52
R7292:Hmcn1	UTSW	1	150733129	splice site	probably null
R7316:Hmcn1	UTSW	1	150732946	missense	probably damaging	1.00
R7327:Hmcn1	UTSW	1	150603814	missense	probably benign	0.01
R7328:Hmcn1	UTSW	1	150638866	missense	possibly damaging	0.95
R7346:Hmcn1	UTSW	1	150683745	missense	probably damaging	1.00
R7351:Hmcn1	UTSW	1	150667889	missense	probably damaging	0.98
R7354:Hmcn1	UTSW	1	150806445	nonsense	probably null
R7360:Hmcn1	UTSW	1	150618846	missense	probably damaging	1.00
R7396:Hmcn1	UTSW	1	150563631	missense	possibly damaging	0.83
R7398:Hmcn1	UTSW	1	150646670	missense	probably benign	0.00
R7400:Hmcn1	UTSW	1	150674430	missense	probably damaging	1.00
R7404:Hmcn1	UTSW	1	150720759	missense	probably benign	0.00
R7424:Hmcn1	UTSW	1	150630266	nonsense	probably null
R7454:Hmcn1	UTSW	1	150563604	missense	probably damaging	1.00
R7476:Hmcn1	UTSW	1	150580267	missense	probably damaging	0.99
R7480:Hmcn1	UTSW	1	150677234	critical splice donor site	probably null
R7516:Hmcn1	UTSW	1	150622967	missense	probably benign	0.35
R7526:Hmcn1	UTSW	1	150656573	missense	probably damaging	1.00
R7531:Hmcn1	UTSW	1	150686780	missense	probably benign	0.06
R7555:Hmcn1	UTSW	1	150604874	missense	probably benign	0.40
R7564:Hmcn1	UTSW	1	150655835	missense	probably benign
R7588:Hmcn1	UTSW	1	150657134	missense	possibly damaging	0.90
R7719:Hmcn1	UTSW	1	150565329	missense	possibly damaging	0.95
R7720:Hmcn1	UTSW	1	150646709	missense	probably benign	0.00
R7722:Hmcn1	UTSW	1	150667880	missense	probably damaging	0.98
R7761:Hmcn1	UTSW	1	150722445	missense	possibly damaging	0.70
R7787:Hmcn1	UTSW	1	150756592	missense	probably damaging	1.00
R7803:Hmcn1	UTSW	1	150770279	missense	probably benign	0.32
R7862:Hmcn1	UTSW	1	150806421	missense	probably damaging	0.96
R7876:Hmcn1	UTSW	1	150744971	missense	probably benign	0.03
R7886:Hmcn1	UTSW	1	150657470	missense	possibly damaging	0.94
R7891:Hmcn1	UTSW	1	150593189	missense	probably damaging	1.00
R7892:Hmcn1	UTSW	1	150664892	missense	probably benign	0.00
R7927:Hmcn1	UTSW	1	150609775	missense	probably damaging	1.00
R7941:Hmcn1	UTSW	1	150650084	missense	possibly damaging	0.95
R7960:Hmcn1	UTSW	1	150655855	missense	probably damaging	1.00
R8001:Hmcn1	UTSW	1	150664878	nonsense	probably null
R8015:Hmcn1	UTSW	1	150598311	missense	possibly damaging	0.83
R8070:Hmcn1	UTSW	1	150649992	nonsense	probably null
R8072:Hmcn1	UTSW	1	150656505	missense	possibly damaging	0.62
R8113:Hmcn1	UTSW	1	150749090	missense	possibly damaging	0.50
R8143:Hmcn1	UTSW	1	150859206	missense	probably benign	0.03
R8145:Hmcn1	UTSW	1	150753660	missense	probably benign	0.33
R8155:Hmcn1	UTSW	1	150604954	missense	probably damaging	1.00
R8165:Hmcn1	UTSW	1	150646658	missense	probably benign	0.09
R8179:Hmcn1	UTSW	1	150722514	missense	probably benign	0.19
R8193:Hmcn1	UTSW	1	150577477	nonsense	probably null
R8234:Hmcn1	UTSW	1	150594010	missense	possibly damaging	0.83
R8249:Hmcn1	UTSW	1	150819366	missense	probably benign	0.24
R8267:Hmcn1	UTSW	1	150859254	missense	probably damaging	1.00
R8312:Hmcn1	UTSW	1	150738764	missense	probably damaging	0.99
R8338:Hmcn1	UTSW	1	150738734	missense	probably benign	0.35
R8354:Hmcn1	UTSW	1	150758391	missense	possibly damaging	0.79
R8440:Hmcn1	UTSW	1	150694920	missense	probably damaging	1.00
R8473:Hmcn1	UTSW	1	150603800	missense	possibly damaging	0.64
R8497:Hmcn1	UTSW	1	150580239	missense	probably benign	0.01
R8509:Hmcn1	UTSW	1	150573551	nonsense	probably null
R8559:Hmcn1	UTSW	1	150676038	missense	probably benign	0.25
R8701:Hmcn1	UTSW	1	150755257	missense	probably benign	0.00
R8755:Hmcn1	UTSW	1	150633620	missense	probably benign	0.19
R8765:Hmcn1	UTSW	1	150680662	missense	probably damaging	0.98
R8782:Hmcn1	UTSW	1	150664885	missense	probably benign	0.08
R8794:Hmcn1	UTSW	1	150715718	missense	probably benign	0.00
R8803:Hmcn1	UTSW	1	150734497	missense	probably damaging	1.00
R8808:Hmcn1	UTSW	1	150655819	missense	possibly damaging	0.64
R8853:Hmcn1	UTSW	1	150671975	missense	probably damaging	1.00
R8877:Hmcn1	UTSW	1	150638908	missense	probably benign	0.00
R8881:Hmcn1	UTSW	1	150649972	missense	probably damaging	1.00
R8916:Hmcn1	UTSW	1	150773779	missense	probably damaging	1.00
R9008:Hmcn1	UTSW	1	150755044	intron	probably benign
R9030:Hmcn1	UTSW	1	150817119	missense	probably benign	0.00
R9072:Hmcn1	UTSW	1	150689569	missense	probably benign	0.04
R9090:Hmcn1	UTSW	1	150756558	missense	probably damaging	1.00
R9096:Hmcn1	UTSW	1	150657118	missense	probably benign	0.04
R9102:Hmcn1	UTSW	1	150697580	missense	probably benign	0.01
R9146:Hmcn1	UTSW	1	150598390	missense	probably benign	0.02
R9157:Hmcn1	UTSW	1	150646592	missense	probably benign	0.06
R9169:Hmcn1	UTSW	1	150630341	missense	probably damaging	0.99
R9182:Hmcn1	UTSW	1	150612654	missense	probably damaging	1.00
R9182:Hmcn1	UTSW	1	150624586	nonsense	probably null
R9204:Hmcn1	UTSW	1	150734511	missense	probably benign	0.40
R9219:Hmcn1	UTSW	1	150719093	critical splice donor site	probably null
R9267:Hmcn1	UTSW	1	150597989	missense	probably benign	0.26
R9271:Hmcn1	UTSW	1	150756558	missense	probably damaging	1.00
R9274:Hmcn1	UTSW	1	150630295	missense	probably benign	0.01
R9313:Hmcn1	UTSW	1	150646592	missense	probably benign	0.06
R9414:Hmcn1	UTSW	1	150669436	missense	probably damaging	1.00
R9456:Hmcn1	UTSW	1	150630302	nonsense	probably null
R9464:Hmcn1	UTSW	1	150723497	missense	possibly damaging	0.80
R9474:Hmcn1	UTSW	1	150630720	missense	probably damaging	1.00
R9476:Hmcn1	UTSW	1	150586376	missense	probably benign	0.00
R9482:Hmcn1	UTSW	1	150734530	missense	probably benign	0.06
R9496:Hmcn1	UTSW	1	150704220	missense	probably benign	0.00
R9501:Hmcn1	UTSW	1	150595239	missense	possibly damaging	0.67
R9510:Hmcn1	UTSW	1	150586376	missense	probably benign	0.00
R9529:Hmcn1	UTSW	1	150669424	missense	probably damaging	1.00
R9566:Hmcn1	UTSW	1	150622909	missense	probably benign	0.00
R9608:Hmcn1	UTSW	1	150599552	missense	probably damaging	1.00
R9609:Hmcn1	UTSW	1	150679595	missense	probably damaging	0.96
R9616:Hmcn1	UTSW	1	150808722	missense	probably benign	0.16
R9627:Hmcn1	UTSW	1	150630303	missense	probably damaging	1.00
R9668:Hmcn1	UTSW	1	150743741	missense	probably benign	0.02
R9686:Hmcn1	UTSW	1	150737605	missense	probably damaging	0.99
R9717:Hmcn1	UTSW	1	150609627	missense	probably damaging	1.00
R9727:Hmcn1	UTSW	1	150798815	missense	probably benign	0.06
R9744:Hmcn1	UTSW	1	150748190	missense	probably damaging	1.00
R9749:Hmcn1	UTSW	1	150756588	missense	possibly damaging	0.94
R9761:Hmcn1	UTSW	1	150992874	missense	probably damaging	0.98
R9783:Hmcn1	UTSW	1	150722629	missense	probably benign	0.16
R9788:Hmcn1	UTSW	1	150652582	missense	probably benign	0.00
R9792:Hmcn1	UTSW	1	150732938	missense	possibly damaging	0.94
R9793:Hmcn1	UTSW	1	150732938	missense	possibly damaging	0.94
R9795:Hmcn1	UTSW	1	150732938	missense	possibly damaging	0.94
R9802:Hmcn1	UTSW	1	150808640	missense	probably benign	0.07
RF003:Hmcn1	UTSW	1	150624561	missense	probably damaging	1.00
RF005:Hmcn1	UTSW	1	150635146	nonsense	probably null
X0022:Hmcn1	UTSW	1	150700530	missense	probably benign	0.04
X0027:Hmcn1	UTSW	1	150860376	missense	probably damaging	1.00
X0028:Hmcn1	UTSW	1	150663901	missense	probably damaging	1.00
Z1088:Hmcn1	UTSW	1	150648937	missense	probably damaging	1.00
Z1176:Hmcn1	UTSW	1	150586445	missense	probably null	0.92
Z1176:Hmcn1	UTSW	1	150655921	missense	possibly damaging	0.65
Z1176:Hmcn1	UTSW	1	150663917	missense	probably benign	0.12

Predicted Primers

PCR Primer
(F):5'- CTGAGATCAGGTCTAATGGTAGG -3'
(R):5'- GGTGTAACATGCCTTACTAAAGCC -3'

Sequencing Primer
(F):5'- GATCAGGTCTAATGGTAGGAATAGAG -3'
(R):5'- CTTAGTGCCACCAGTTATCAAGGG -3'

Posted On

2018-05-21