Mutagenetix > Incidental Mutation

Incidental Mutation 'R6478:Col5a1'

516881

Institutional Source

Beutler Lab

Gene Symbol

Col5a1

Ensembl Gene

ENSMUSG00000026837

Gene Name

collagen, type V, alpha 1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6478 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

27886425-28039514 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 27952436 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 441 (I441N)

Ref Sequence

ENSEMBL: ENSMUSP00000028280 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028280]

AlphaFold

O88207

Predicted Effect

unknown
Transcript: ENSMUST00000028280
AA Change: I441N

SMART Domains

Protein: ENSMUSP00000028280
Gene: ENSMUSG00000026837
AA Change: I441N

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
TSPN	39	230	5.7e-73	SMART
LamG	98	229	6.86e-3	SMART
low complexity region	259	288	N/A	INTRINSIC
low complexity region	300	314	N/A	INTRINSIC
low complexity region	335	352	N/A	INTRINSIC
low complexity region	374	387	N/A	INTRINSIC
low complexity region	412	428	N/A	INTRINSIC
internal_repeat_7	443	457	9.97e-7	PROSPERO
Pfam:Collagen	467	519	4e-10	PFAM
Pfam:Collagen	557	619	6.5e-9	PFAM
internal_repeat_2	622	642	1.83e-11	PROSPERO
low complexity region	643	698	N/A	INTRINSIC
low complexity region	712	757	N/A	INTRINSIC
low complexity region	760	793	N/A	INTRINSIC
internal_repeat_5	794	817	3.78e-8	PROSPERO
internal_repeat_7	798	812	9.97e-7	PROSPERO
internal_repeat_8	802	821	8.84e-6	PROSPERO
low complexity region	826	862	N/A	INTRINSIC
internal_repeat_3	865	889	2.79e-10	PROSPERO
internal_repeat_5	869	892	3.78e-8	PROSPERO
low complexity region	895	925	N/A	INTRINSIC
internal_repeat_2	928	948	1.83e-11	PROSPERO
internal_repeat_4	928	948	1.27e-8	PROSPERO
low complexity region	949	979	N/A	INTRINSIC
low complexity region	984	1033	N/A	INTRINSIC
internal_repeat_4	1039	1062	1.27e-8	PROSPERO
internal_repeat_1	1039	1063	5.12e-15	PROSPERO
internal_repeat_3	1048	1072	2.79e-10	PROSPERO
internal_repeat_6	1049	1072	1.13e-7	PROSPERO
low complexity region	1075	1117	N/A	INTRINSIC
low complexity region	1134	1165	N/A	INTRINSIC
low complexity region	1174	1193	N/A	INTRINSIC
internal_repeat_8	1195	1214	8.84e-6	PROSPERO
low complexity region	1215	1243	N/A	INTRINSIC
low complexity region	1249	1282	N/A	INTRINSIC
low complexity region	1285	1421	N/A	INTRINSIC
internal_repeat_1	1423	1447	5.12e-15	PROSPERO
Pfam:Collagen	1460	1529	8.4e-9	PFAM
Pfam:Collagen	1513	1575	1.2e-9	PFAM
COLFI	1608	1837	3.33e-153	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.3%

Validation Efficiency

95% (75/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha chain for one of the low abundance fibrillar collagens. Fibrillar collagen molecules are trimers that can be composed of one or more types of alpha chains. Type V collagen is found in tissues containing type I collagen and appears to regulate the assembly of heterotypic fibers composed of both type I and type V collagen. This gene product is closely related to type XI collagen and it is possible that the collagen chains of types V and XI constitute a single collagen type with tissue-specific chain combinations. The encoded procollagen protein occurs commonly as the heterotrimer pro-alpha1(V)-pro-alpha1(V)-pro-alpha2(V). Mutations in this gene are associated with Ehlers-Danlos syndrome, types I and II. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutation of this gene results in lethality around E10-11 due to cardiovascular insufficiency and lack of collagen fibril formation. Heterozygotes exhibit poorly organized and less dense fibers in the dermis and reduced skin tensile strength and are a model for Ehlers-Danlos Syndrome. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	A	G	14: 49,773,332	V306A	possibly damaging	Het
9530053A07Rik	C	G	7: 28,155,373	P1808R	probably damaging	Het
Aatk	T	A	11: 120,010,991	S803C	probably benign	Het
Abcc9	C	T	6: 142,679,308	A454T	probably damaging	Het
Abr	T	C	11: 76,452,332	E565G	probably damaging	Het
Adam33	C	A	2: 131,051,346	R753L	probably benign	Het
Adgre1	A	G	17: 57,401,955	T49A	possibly damaging	Het
AI314180	A	T	4: 58,810,785	I1524N	probably damaging	Het
Ankra2	A	T	13: 98,268,442	H153L	probably damaging	Het
Ankrd26	T	G	6: 118,511,638	E1353D	probably benign	Het
Ankrd52	T	G	10: 128,379,331		probably null	Het
Arhgef10l	T	A	4: 140,542,757	T619S	possibly damaging	Het
Asgr1	T	C	11: 70,056,894	V130A	possibly damaging	Het
Atg10	C	A	13: 90,937,347	C161F	probably damaging	Het
Atm	A	T	9: 53,490,254	N1438K	probably damaging	Het
BC107364	T	A	3: 96,436,006		probably null	Het
Bcar3	G	T	3: 122,426,576	A41S	probably benign	Het
Btbd6	A	G	12: 112,977,312		probably benign	Het
Cchcr1	A	G	17: 35,524,703	T318A	possibly damaging	Het
Celsr1	A	T	15: 85,925,518	I2221N	probably damaging	Het
Cept1	C	T	3: 106,533,445	W48*	probably null	Het
Cfap161	T	A	7: 83,793,276	I85L	probably benign	Het
Clasp1	A	T	1: 118,512,180	R640*	probably null	Het
Col9a1	C	A	1: 24,185,405	L223I	unknown	Het
Dnah2	T	C	11: 69,516,010	D223G	probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Dpy19l1	A	T	9: 24,450,696	M129K	possibly damaging	Het
Fcrl1	C	A	3: 87,389,639	H318Q	probably benign	Het
Fer1l5	A	G	1: 36,402,531	N609S	probably damaging	Het
Fkbp4	C	T	6: 128,433,231	E256K	probably damaging	Het
Fsip2	A	G	2: 82,990,086	T5388A	possibly damaging	Het
Glrx	G	A	13: 75,847,299		probably null	Het
Gm6614	A	T	6: 141,993,642	N208K	possibly damaging	Het
Gm7356	A	T	17: 14,001,464	M101K	probably damaging	Het
Gstp2	A	T	19: 4,040,499	I162N	probably benign	Het
Hectd3	A	C	4: 116,999,586	K443N	probably damaging	Het
Hmcn1	T	A	1: 150,664,784	R2925W	probably damaging	Het
Hspa1a	G	T	17: 34,970,306	N540K	probably damaging	Het
Ints6	A	T	14: 62,700,786	M649K	probably benign	Het
Katnb1	T	C	8: 95,095,456	V270A	possibly damaging	Het
Kctd3	A	G	1: 188,972,364	S737P	probably benign	Het
Klra10	T	C	6: 130,272,544		probably null	Het
Lmtk3	A	G	7: 45,798,589	D1353G	unknown	Het
Lrrk1	A	G	7: 66,262,733	V1693A	probably damaging	Het
Mpnd	A	T	17: 56,009,575	I85F	probably damaging	Het
Myo3b	A	G	2: 70,348,960	T1173A	probably benign	Het
Myof	G	A	19: 37,903,831	P1158L	probably damaging	Het
Naip2	A	C	13: 100,162,041	S496A	probably benign	Het
Ncor2	A	G	5: 125,110,005		probably benign	Het
Npepps	C	T	11: 97,258,273		probably null	Het
Olfr1247	T	G	2: 89,609,446	I219L	probably damaging	Het
Opn5	T	A	17: 42,580,749	I266F	probably benign	Het
P2rx4	A	G	5: 122,707,700	D16G	probably damaging	Het
Padi2	G	T	4: 140,917,637	V61L	probably benign	Het
Pkd1l1	G	A	11: 8,863,911	T1480I	probably benign	Het
Plcb1	T	C	2: 135,335,451	S568P	probably damaging	Het
Rassf10	A	G	7: 112,955,707	E505G	probably damaging	Het
Rcan2	A	G	17: 43,836,334	E21G	probably benign	Het
Rhob	G	T	12: 8,499,585	C16*	probably null	Het
Ryr3	T	C	2: 112,660,068	N3807S	probably damaging	Het
Sass6	T	A	3: 116,621,397	N519K	probably benign	Het
Smad9	A	T	3: 54,782,443	D28V	probably damaging	Het
Tepp	A	T	8: 95,321,266		probably null	Het
Tex14	G	T	11: 87,514,373	G704C	probably benign	Het
Tmc3	A	G	7: 83,622,316	N892S	probably benign	Het
Tnfaip2	T	A	12: 111,445,663	L166Q	probably damaging	Het
Triml2	A	G	8: 43,185,128		probably null	Het
Trio	A	G	15: 27,856,107	V666A	probably benign	Het
Tshz2	G	T	2: 169,884,664	L393F	probably damaging	Het
Ttn	T	G	2: 76,841,771		probably benign	Het
Tubb5	A	G	17: 35,835,842	Y159H	probably damaging	Het
Umodl1	A	G	17: 30,959,155	Y35C	probably damaging	Het
Utp4	T	C	8: 106,904,446		probably null	Het
Vmn1r60	A	T	7: 5,544,865	C79S	probably damaging	Het
Wnt5b	T	C	6: 119,433,790	T230A	probably damaging	Het
Zfp618	A	T	4: 63,132,706	I575F	probably damaging	Het
Zmym6	G	T	4: 127,123,383	V894L	possibly damaging	Het
Zpbp	T	C	11: 11,462,318		probably benign	Het

Other mutations in Col5a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01291:Col5a1	APN	2	27971444	splice site	probably benign
IGL01340:Col5a1	APN	2	27960451	missense	unknown
IGL01938:Col5a1	APN	2	27996873	missense	unknown
IGL02167:Col5a1	APN	2	28018556	missense	probably benign
IGL02670:Col5a1	APN	2	27974715	missense	unknown
IGL02672:Col5a1	APN	2	27974715	missense	unknown
IGL02673:Col5a1	APN	2	27974715	missense	unknown
IGL02832:Col5a1	APN	2	27952340	missense	unknown
IGL03065:Col5a1	APN	2	28032745	missense	possibly damaging	0.61
IGL03196:Col5a1	APN	2	27975598	missense	unknown
PIT4131001:Col5a1	UTSW	2	28024653	missense	probably benign	0.01
PIT4495001:Col5a1	UTSW	2	28024776	missense	unknown
R0136:Col5a1	UTSW	2	28024831	missense	probably damaging	1.00
R0485:Col5a1	UTSW	2	27990097	splice site	probably benign
R0626:Col5a1	UTSW	2	27928243	nonsense	probably null
R0666:Col5a1	UTSW	2	28032685	missense	probably damaging	1.00
R1268:Col5a1	UTSW	2	28002489	missense	unknown
R1302:Col5a1	UTSW	2	28005236	missense	probably damaging	1.00
R1416:Col5a1	UTSW	2	27922064	missense	unknown
R1466:Col5a1	UTSW	2	28003846	splice site	probably benign
R1617:Col5a1	UTSW	2	27952381	missense	unknown
R1650:Col5a1	UTSW	2	27922159	missense	unknown
R1663:Col5a1	UTSW	2	27951476	missense	unknown
R1901:Col5a1	UTSW	2	27960444	missense	unknown
R1970:Col5a1	UTSW	2	27986754	missense	unknown
R2377:Col5a1	UTSW	2	27928177	missense	unknown
R2396:Col5a1	UTSW	2	27986729	missense	unknown
R4297:Col5a1	UTSW	2	28017204	critical splice donor site	probably null
R4385:Col5a1	UTSW	2	28024779	missense	probably damaging	1.00
R4803:Col5a1	UTSW	2	28011341	missense	unknown
R4835:Col5a1	UTSW	2	28025644	missense	probably damaging	1.00
R4935:Col5a1	UTSW	2	28024742	missense	probably damaging	1.00
R4994:Col5a1	UTSW	2	28032739	missense	possibly damaging	0.90
R4997:Col5a1	UTSW	2	28032782	nonsense	probably null
R5061:Col5a1	UTSW	2	27952378	missense	unknown
R5088:Col5a1	UTSW	2	28018602	nonsense	probably null
R5089:Col5a1	UTSW	2	28018602	nonsense	probably null
R5090:Col5a1	UTSW	2	28018602	nonsense	probably null
R5114:Col5a1	UTSW	2	28025652	missense	probably damaging	1.00
R5409:Col5a1	UTSW	2	27960445	missense	unknown
R5649:Col5a1	UTSW	2	27951456	missense	unknown
R5699:Col5a1	UTSW	2	27997599	missense	unknown
R5910:Col5a1	UTSW	2	28036888	missense	possibly damaging	0.89
R6053:Col5a1	UTSW	2	28014377	unclassified	probably benign
R6210:Col5a1	UTSW	2	28032621	missense	probably benign	0.04
R6363:Col5a1	UTSW	2	27928195	missense	unknown
R6600:Col5a1	UTSW	2	27997571	missense	unknown
R7047:Col5a1	UTSW	2	27928084	missense	unknown
R7061:Col5a1	UTSW	2	28025678	nonsense	probably null
R7131:Col5a1	UTSW	2	27929486	missense	unknown
R7202:Col5a1	UTSW	2	27952378	missense	unknown
R7270:Col5a1	UTSW	2	27997585	missense	unknown
R7385:Col5a1	UTSW	2	28024750	missense	unknown
R7492:Col5a1	UTSW	2	27969800	critical splice donor site	probably null
R7570:Col5a1	UTSW	2	27951383	missense	unknown
R7627:Col5a1	UTSW	2	27950653	nonsense	probably null
R8003:Col5a1	UTSW	2	27958328	intron	probably benign
R8011:Col5a1	UTSW	2	27980521	splice site	probably benign
R8073:Col5a1	UTSW	2	27962129	missense	possibly damaging	0.85
R8217:Col5a1	UTSW	2	27922123	missense	unknown
R8879:Col5a1	UTSW	2	28014158	missense	unknown
R8911:Col5a1	UTSW	2	27997618	critical splice donor site	probably null
R9082:Col5a1	UTSW	2	27962110	missense	possibly damaging	0.73
R9095:Col5a1	UTSW	2	28024653	missense	probably benign	0.01
R9170:Col5a1	UTSW	2	27951351	missense	unknown
R9264:Col5a1	UTSW	2	27964111	missense	unknown
R9265:Col5a1	UTSW	2	27964111	missense	unknown
R9461:Col5a1	UTSW	2	28032604	missense	unknown
R9596:Col5a1	UTSW	2	27929539	nonsense	probably null
R9614:Col5a1	UTSW	2	27989174	missense	unknown
R9691:Col5a1	UTSW	2	27952982	missense	unknown
R9743:Col5a1	UTSW	2	27974493	missense	unknown
Z1176:Col5a1	UTSW	2	28002517	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TCCCTTAATCTGCAGCCAGC -3'
(R):5'- CCATAACAGGAATCAGAGAGGCTAC -3'

Sequencing Primer
(F):5'- TTAATCTGCAGCCAGCTCCAGG -3'
(R):5'- CTACATAGAGAGTTTCTGGACAGCC -3'

Posted On

2018-05-21