Incidental Mutation 'R6478:AI314180'
ID516895
Institutional Source Beutler Lab
Gene Symbol AI314180
Ensembl Gene ENSMUSG00000050812
Gene Nameexpressed sequence AI314180
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.579) question?
Stock #R6478 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location58798911-58912749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58810785 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1524 (I1524N)
Ref Sequence ENSEMBL: ENSMUSP00000099953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102889] [ENSMUST00000149301]
Predicted Effect probably damaging
Transcript: ENSMUST00000102889
AA Change: I1524N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099953
Gene: ENSMUSG00000050812
AA Change: I1524N

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 1.1e-155 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
SCOP:d1qbkb_ 693 1491 3e-31 SMART
low complexity region 1781 1797 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131611
Predicted Effect probably benign
Transcript: ENSMUST00000149301
SMART Domains Protein: ENSMUSP00000117585
Gene: ENSMUSG00000050812

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 4e-163 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
SCOP:d1qbkb_ 693 1490 8e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149513
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 95% (75/79)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,773,332 V306A possibly damaging Het
9530053A07Rik C G 7: 28,155,373 P1808R probably damaging Het
Aatk T A 11: 120,010,991 S803C probably benign Het
Abcc9 C T 6: 142,679,308 A454T probably damaging Het
Abr T C 11: 76,452,332 E565G probably damaging Het
Adam33 C A 2: 131,051,346 R753L probably benign Het
Adgre1 A G 17: 57,401,955 T49A possibly damaging Het
Ankra2 A T 13: 98,268,442 H153L probably damaging Het
Ankrd26 T G 6: 118,511,638 E1353D probably benign Het
Ankrd52 T G 10: 128,379,331 probably null Het
Arhgef10l T A 4: 140,542,757 T619S possibly damaging Het
Asgr1 T C 11: 70,056,894 V130A possibly damaging Het
Atg10 C A 13: 90,937,347 C161F probably damaging Het
Atm A T 9: 53,490,254 N1438K probably damaging Het
BC107364 T A 3: 96,436,006 probably null Het
Bcar3 G T 3: 122,426,576 A41S probably benign Het
Btbd6 A G 12: 112,977,312 probably benign Het
Cchcr1 A G 17: 35,524,703 T318A possibly damaging Het
Celsr1 A T 15: 85,925,518 I2221N probably damaging Het
Cept1 C T 3: 106,533,445 W48* probably null Het
Cfap161 T A 7: 83,793,276 I85L probably benign Het
Clasp1 A T 1: 118,512,180 R640* probably null Het
Col5a1 T A 2: 27,952,436 I441N unknown Het
Col9a1 C A 1: 24,185,405 L223I unknown Het
Dnah2 T C 11: 69,516,010 D223G probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dpy19l1 A T 9: 24,450,696 M129K possibly damaging Het
Fcrl1 C A 3: 87,389,639 H318Q probably benign Het
Fer1l5 A G 1: 36,402,531 N609S probably damaging Het
Fkbp4 C T 6: 128,433,231 E256K probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Glrx G A 13: 75,847,299 probably null Het
Gm6614 A T 6: 141,993,642 N208K possibly damaging Het
Gm7356 A T 17: 14,001,464 M101K probably damaging Het
Gstp2 A T 19: 4,040,499 I162N probably benign Het
Hectd3 A C 4: 116,999,586 K443N probably damaging Het
Hmcn1 T A 1: 150,664,784 R2925W probably damaging Het
Hspa1a G T 17: 34,970,306 N540K probably damaging Het
Ints6 A T 14: 62,700,786 M649K probably benign Het
Katnb1 T C 8: 95,095,456 V270A possibly damaging Het
Kctd3 A G 1: 188,972,364 S737P probably benign Het
Klra10 T C 6: 130,272,544 probably null Het
Lmtk3 A G 7: 45,798,589 D1353G unknown Het
Lrrk1 A G 7: 66,262,733 V1693A probably damaging Het
Mpnd A T 17: 56,009,575 I85F probably damaging Het
Myo3b A G 2: 70,348,960 T1173A probably benign Het
Myof G A 19: 37,903,831 P1158L probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Ncor2 A G 5: 125,110,005 probably benign Het
Npepps C T 11: 97,258,273 probably null Het
Olfr1247 T G 2: 89,609,446 I219L probably damaging Het
Opn5 T A 17: 42,580,749 I266F probably benign Het
P2rx4 A G 5: 122,707,700 D16G probably damaging Het
Padi2 G T 4: 140,917,637 V61L probably benign Het
Pkd1l1 G A 11: 8,863,911 T1480I probably benign Het
Plcb1 T C 2: 135,335,451 S568P probably damaging Het
Rassf10 A G 7: 112,955,707 E505G probably damaging Het
Rcan2 A G 17: 43,836,334 E21G probably benign Het
Rhob G T 12: 8,499,585 C16* probably null Het
Ryr3 T C 2: 112,660,068 N3807S probably damaging Het
Sass6 T A 3: 116,621,397 N519K probably benign Het
Smad9 A T 3: 54,782,443 D28V probably damaging Het
Tepp A T 8: 95,321,266 probably null Het
Tex14 G T 11: 87,514,373 G704C probably benign Het
Tmc3 A G 7: 83,622,316 N892S probably benign Het
Tnfaip2 T A 12: 111,445,663 L166Q probably damaging Het
Triml2 A G 8: 43,185,128 probably null Het
Trio A G 15: 27,856,107 V666A probably benign Het
Tshz2 G T 2: 169,884,664 L393F probably damaging Het
Ttn T G 2: 76,841,771 probably benign Het
Tubb5 A G 17: 35,835,842 Y159H probably damaging Het
Umodl1 A G 17: 30,959,155 Y35C probably damaging Het
Utp4 T C 8: 106,904,446 probably null Het
Vmn1r60 A T 7: 5,544,865 C79S probably damaging Het
Wnt5b T C 6: 119,433,790 T230A probably damaging Het
Zfp618 A T 4: 63,132,706 I575F probably damaging Het
Zmym6 G T 4: 127,123,383 V894L possibly damaging Het
Zpbp T C 11: 11,462,318 probably benign Het
Other mutations in AI314180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:AI314180 APN 4 58828047 missense possibly damaging 0.95
IGL01145:AI314180 APN 4 58811501 missense probably null 0.08
IGL01371:AI314180 APN 4 58809718 missense probably damaging 1.00
IGL01445:AI314180 APN 4 58833988 missense probably benign 0.08
IGL01452:AI314180 APN 4 58836181 missense probably damaging 0.99
IGL01626:AI314180 APN 4 58832814 splice site probably benign
IGL01672:AI314180 APN 4 58814041 missense probably benign 0.40
IGL01943:AI314180 APN 4 58849937 missense possibly damaging 0.91
IGL01944:AI314180 APN 4 58861544 missense probably benign 0.42
IGL02190:AI314180 APN 4 58800190 missense probably benign 0.12
IGL02272:AI314180 APN 4 58811731 missense probably benign 0.00
IGL02435:AI314180 APN 4 58830325 splice site probably benign
IGL02516:AI314180 APN 4 58877102 missense probably damaging 1.00
IGL02540:AI314180 APN 4 58805534 splice site probably benign
IGL02709:AI314180 APN 4 58872699 missense possibly damaging 0.90
IGL02742:AI314180 APN 4 58840757 missense probably damaging 0.96
IGL02812:AI314180 APN 4 58864343 splice site probably benign
IGL02828:AI314180 APN 4 58875512 missense possibly damaging 0.59
IGL03130:AI314180 APN 4 58800288 missense probably benign
IGL03179:AI314180 APN 4 58832777 missense probably damaging 1.00
IGL03237:AI314180 APN 4 58810668 missense probably benign 0.40
IGL03344:AI314180 APN 4 58828538 missense probably damaging 1.00
R0051:AI314180 UTSW 4 58832729 missense probably damaging 1.00
R0051:AI314180 UTSW 4 58832729 missense probably damaging 1.00
R0313:AI314180 UTSW 4 58811892 missense probably benign 0.11
R0399:AI314180 UTSW 4 58827047 missense possibly damaging 0.69
R0487:AI314180 UTSW 4 58819155 missense probably damaging 1.00
R0492:AI314180 UTSW 4 58864418 missense probably damaging 1.00
R0705:AI314180 UTSW 4 58885366 critical splice donor site probably null
R0847:AI314180 UTSW 4 58841439 missense probably benign 0.14
R1467:AI314180 UTSW 4 58832753 missense probably benign
R1467:AI314180 UTSW 4 58832753 missense probably benign
R1482:AI314180 UTSW 4 58820163 missense possibly damaging 0.85
R1529:AI314180 UTSW 4 58832701 splice site probably null
R1771:AI314180 UTSW 4 58879100 missense probably damaging 1.00
R1776:AI314180 UTSW 4 58879100 missense probably damaging 1.00
R1822:AI314180 UTSW 4 58805539 critical splice donor site probably null
R1864:AI314180 UTSW 4 58849942 missense possibly damaging 0.62
R2029:AI314180 UTSW 4 58844165 nonsense probably null
R2061:AI314180 UTSW 4 58824270 missense probably damaging 1.00
R2125:AI314180 UTSW 4 58833978 missense probably benign
R2266:AI314180 UTSW 4 58830332 critical splice donor site probably null
R2889:AI314180 UTSW 4 58836165 missense probably benign
R2902:AI314180 UTSW 4 58809691 missense probably benign 0.31
R2903:AI314180 UTSW 4 58828622 missense possibly damaging 0.50
R2925:AI314180 UTSW 4 58833928 nonsense probably null
R4151:AI314180 UTSW 4 58836254 missense possibly damaging 0.51
R4225:AI314180 UTSW 4 58847027 missense probably damaging 1.00
R4486:AI314180 UTSW 4 58820086 intron probably benign
R4576:AI314180 UTSW 4 58834708 intron probably benign
R4580:AI314180 UTSW 4 58840751 missense probably damaging 1.00
R4654:AI314180 UTSW 4 58834523 missense possibly damaging 0.86
R4688:AI314180 UTSW 4 58840757 missense probably damaging 0.96
R4726:AI314180 UTSW 4 58844191 missense probably damaging 1.00
R4825:AI314180 UTSW 4 58850911 missense probably damaging 0.99
R4928:AI314180 UTSW 4 58827073 missense probably damaging 1.00
R5098:AI314180 UTSW 4 58877048 missense probably damaging 1.00
R5284:AI314180 UTSW 4 58836172 missense possibly damaging 0.90
R5375:AI314180 UTSW 4 58809401 nonsense probably null
R5382:AI314180 UTSW 4 58850934 missense probably benign 0.38
R5487:AI314180 UTSW 4 58809421 missense probably benign 0.22
R5703:AI314180 UTSW 4 58877171 splice site probably null
R5761:AI314180 UTSW 4 58853131 missense probably damaging 1.00
R5791:AI314180 UTSW 4 58814027 missense possibly damaging 0.90
R5791:AI314180 UTSW 4 58822111 missense probably damaging 1.00
R5928:AI314180 UTSW 4 58849948 missense possibly damaging 0.59
R6062:AI314180 UTSW 4 58826453 missense possibly damaging 0.84
R6246:AI314180 UTSW 4 58811365 splice site probably null
R6298:AI314180 UTSW 4 58877157 missense probably damaging 1.00
R6326:AI314180 UTSW 4 58827068 missense probably benign 0.34
R6707:AI314180 UTSW 4 58879101 missense possibly damaging 0.52
R6846:AI314180 UTSW 4 58814081 missense possibly damaging 0.85
R6857:AI314180 UTSW 4 58814065 missense probably damaging 1.00
R6951:AI314180 UTSW 4 58853114 critical splice donor site probably null
R7088:AI314180 UTSW 4 58849766 missense possibly damaging 0.93
R7302:AI314180 UTSW 4 58834593 missense probably benign 0.43
R7337:AI314180 UTSW 4 58827047 missense possibly damaging 0.69
R7341:AI314180 UTSW 4 58809415 missense possibly damaging 0.94
R7344:AI314180 UTSW 4 58824770 missense probably benign 0.08
R7525:AI314180 UTSW 4 58847038 missense possibly damaging 0.84
R7530:AI314180 UTSW 4 58815317 missense probably damaging 0.99
R7533:AI314180 UTSW 4 58809411 missense probably benign 0.12
R7557:AI314180 UTSW 4 58849691 missense possibly damaging 0.85
R7698:AI314180 UTSW 4 58832660 missense unknown
R7793:AI314180 UTSW 4 58853150 missense probably damaging 1.00
X0060:AI314180 UTSW 4 58840752 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AGTCTACAAGAAGCTCCAGGCC -3'
(R):5'- CTCTCCCATTAGCAGGTGGTATG -3'

Sequencing Primer
(F):5'- AGCTCTTCGGCATGAGTTC -3'
(R):5'- CCCATTAGCAGGTGGTATGTTTCTC -3'
Posted On2018-05-21