Incidental Mutation 'R6478:Padi2'
ID516900
Institutional Source Beutler Lab
Gene Symbol Padi2
Ensembl Gene ENSMUSG00000028927
Gene Namepeptidyl arginine deiminase, type II
SynonymsPAD type II, Pdi, Pdi2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R6478 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location140906344-140952586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 140917637 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 61 (V61L)
Ref Sequence ENSEMBL: ENSMUSP00000030765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030765]
Predicted Effect probably benign
Transcript: ENSMUST00000030765
AA Change: V61L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000030765
Gene: ENSMUSG00000028927
AA Change: V61L

DomainStartEndE-ValueType
Pfam:PAD_N 9 122 1.7e-36 PFAM
Pfam:PAD_M 124 282 4e-71 PFAM
Pfam:PAD 292 670 3.8e-174 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082509
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 95% (75/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. The type II enzyme is the most widely expressed family member. Known substrates for this enzyme include myelin basic protein in the central nervous system and vimentin in skeletal muscle and macrophages. This enzyme is thought to play a role in the onset and progression of neurodegenerative human disorders, including Alzheimer disease and multiple sclerosis, and it has also been implicated in glaucoma pathogenesis. This gene exists in a cluster with four other paralogous genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired ATP- or calcium ionophore ionomycin-induced citrullination of mast cells or of proteins following induction of EAE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,773,332 V306A possibly damaging Het
9530053A07Rik C G 7: 28,155,373 P1808R probably damaging Het
Aatk T A 11: 120,010,991 S803C probably benign Het
Abcc9 C T 6: 142,679,308 A454T probably damaging Het
Abr T C 11: 76,452,332 E565G probably damaging Het
Adam33 C A 2: 131,051,346 R753L probably benign Het
Adgre1 A G 17: 57,401,955 T49A possibly damaging Het
AI314180 A T 4: 58,810,785 I1524N probably damaging Het
Ankra2 A T 13: 98,268,442 H153L probably damaging Het
Ankrd26 T G 6: 118,511,638 E1353D probably benign Het
Ankrd52 T G 10: 128,379,331 probably null Het
Arhgef10l T A 4: 140,542,757 T619S possibly damaging Het
Asgr1 T C 11: 70,056,894 V130A possibly damaging Het
Atg10 C A 13: 90,937,347 C161F probably damaging Het
Atm A T 9: 53,490,254 N1438K probably damaging Het
BC107364 T A 3: 96,436,006 probably null Het
Bcar3 G T 3: 122,426,576 A41S probably benign Het
Btbd6 A G 12: 112,977,312 probably benign Het
Cchcr1 A G 17: 35,524,703 T318A possibly damaging Het
Celsr1 A T 15: 85,925,518 I2221N probably damaging Het
Cept1 C T 3: 106,533,445 W48* probably null Het
Cfap161 T A 7: 83,793,276 I85L probably benign Het
Clasp1 A T 1: 118,512,180 R640* probably null Het
Col5a1 T A 2: 27,952,436 I441N unknown Het
Col9a1 C A 1: 24,185,405 L223I unknown Het
Dnah2 T C 11: 69,516,010 D223G probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dpy19l1 A T 9: 24,450,696 M129K possibly damaging Het
Fcrl1 C A 3: 87,389,639 H318Q probably benign Het
Fer1l5 A G 1: 36,402,531 N609S probably damaging Het
Fkbp4 C T 6: 128,433,231 E256K probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Glrx G A 13: 75,847,299 probably null Het
Gm6614 A T 6: 141,993,642 N208K possibly damaging Het
Gm7356 A T 17: 14,001,464 M101K probably damaging Het
Gstp2 A T 19: 4,040,499 I162N probably benign Het
Hectd3 A C 4: 116,999,586 K443N probably damaging Het
Hmcn1 T A 1: 150,664,784 R2925W probably damaging Het
Hspa1a G T 17: 34,970,306 N540K probably damaging Het
Ints6 A T 14: 62,700,786 M649K probably benign Het
Katnb1 T C 8: 95,095,456 V270A possibly damaging Het
Kctd3 A G 1: 188,972,364 S737P probably benign Het
Klra10 T C 6: 130,272,544 probably null Het
Lmtk3 A G 7: 45,798,589 D1353G unknown Het
Lrrk1 A G 7: 66,262,733 V1693A probably damaging Het
Mpnd A T 17: 56,009,575 I85F probably damaging Het
Myo3b A G 2: 70,348,960 T1173A probably benign Het
Myof G A 19: 37,903,831 P1158L probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Ncor2 A G 5: 125,110,005 probably benign Het
Npepps C T 11: 97,258,273 probably null Het
Olfr1247 T G 2: 89,609,446 I219L probably damaging Het
Opn5 T A 17: 42,580,749 I266F probably benign Het
P2rx4 A G 5: 122,707,700 D16G probably damaging Het
Pkd1l1 G A 11: 8,863,911 T1480I probably benign Het
Plcb1 T C 2: 135,335,451 S568P probably damaging Het
Rassf10 A G 7: 112,955,707 E505G probably damaging Het
Rcan2 A G 17: 43,836,334 E21G probably benign Het
Rhob G T 12: 8,499,585 C16* probably null Het
Ryr3 T C 2: 112,660,068 N3807S probably damaging Het
Sass6 T A 3: 116,621,397 N519K probably benign Het
Smad9 A T 3: 54,782,443 D28V probably damaging Het
Tepp A T 8: 95,321,266 probably null Het
Tex14 G T 11: 87,514,373 G704C probably benign Het
Tmc3 A G 7: 83,622,316 N892S probably benign Het
Tnfaip2 T A 12: 111,445,663 L166Q probably damaging Het
Triml2 A G 8: 43,185,128 probably null Het
Trio A G 15: 27,856,107 V666A probably benign Het
Tshz2 G T 2: 169,884,664 L393F probably damaging Het
Ttn T G 2: 76,841,771 probably benign Het
Tubb5 A G 17: 35,835,842 Y159H probably damaging Het
Umodl1 A G 17: 30,959,155 Y35C probably damaging Het
Utp4 T C 8: 106,904,446 probably null Het
Vmn1r60 A T 7: 5,544,865 C79S probably damaging Het
Wnt5b T C 6: 119,433,790 T230A probably damaging Het
Zfp618 A T 4: 63,132,706 I575F probably damaging Het
Zmym6 G T 4: 127,123,383 V894L possibly damaging Het
Zpbp T C 11: 11,462,318 probably benign Het
Other mutations in Padi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Padi2 APN 4 140917637 missense probably benign 0.27
IGL01374:Padi2 APN 4 140933185 missense probably damaging 1.00
IGL01608:Padi2 APN 4 140932230 missense probably damaging 1.00
IGL02085:Padi2 APN 4 140927157 nonsense probably null
IGL02593:Padi2 APN 4 140949842 missense probably damaging 1.00
IGL02668:Padi2 APN 4 140949880 missense probably benign 0.02
IGL03341:Padi2 APN 4 140927113 missense probably benign 0.06
R0116:Padi2 UTSW 4 140926239 missense probably benign 0.00
R2045:Padi2 UTSW 4 140937930 missense probably damaging 1.00
R2079:Padi2 UTSW 4 140933196 missense probably damaging 1.00
R3022:Padi2 UTSW 4 140937988 missense possibly damaging 0.79
R3079:Padi2 UTSW 4 140949878 missense probably damaging 0.99
R3780:Padi2 UTSW 4 140917737 missense probably benign 0.00
R4250:Padi2 UTSW 4 140906546 missense probably damaging 0.97
R4276:Padi2 UTSW 4 140936548 missense possibly damaging 0.93
R4647:Padi2 UTSW 4 140944446 missense probably damaging 1.00
R5058:Padi2 UTSW 4 140932121 missense probably benign 0.00
R5452:Padi2 UTSW 4 140932071 missense probably benign 0.26
R5471:Padi2 UTSW 4 140933208 missense possibly damaging 0.90
R5489:Padi2 UTSW 4 140944488 missense probably damaging 0.99
R5519:Padi2 UTSW 4 140949222 missense probably damaging 1.00
R5666:Padi2 UTSW 4 140949231 missense possibly damaging 0.76
R5793:Padi2 UTSW 4 140933190 missense probably benign 0.04
R5913:Padi2 UTSW 4 140917641 missense probably benign 0.00
R5929:Padi2 UTSW 4 140944537 critical splice donor site probably null
R5933:Padi2 UTSW 4 140917641 missense probably benign 0.00
R6809:Padi2 UTSW 4 140946766 splice site probably null
R7075:Padi2 UTSW 4 140933217 missense probably damaging 0.96
R7313:Padi2 UTSW 4 140932768 missense probably damaging 0.99
R7380:Padi2 UTSW 4 140917686 nonsense probably null
R7391:Padi2 UTSW 4 140937955 missense probably benign 0.01
R7574:Padi2 UTSW 4 140949337 missense possibly damaging 0.87
R7776:Padi2 UTSW 4 140924345 missense probably benign 0.01
R7791:Padi2 UTSW 4 140917596 missense probably benign 0.00
R7810:Padi2 UTSW 4 140949264 missense possibly damaging 0.91
Z1177:Padi2 UTSW 4 140924335 missense possibly damaging 0.50
Z1177:Padi2 UTSW 4 140949727 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGTGCAAGATTAGCCTTTCAC -3'
(R):5'- TGTGGCTCAGGCTATTCCAG -3'

Sequencing Primer
(F):5'- GTGCAAGATTAGCCTTTCACAATCTC -3'
(R):5'- CTATTCCAGCATGGCTTTGGGC -3'
Posted On2018-05-21