Incidental Mutation 'R6478:Lrrk1'
ID516911
Institutional Source Beutler Lab
Gene Symbol Lrrk1
Ensembl Gene ENSMUSG00000015133
Gene Nameleucine-rich repeat kinase 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6478 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location66226912-66388350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66262733 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1693 (V1693A)
Ref Sequence ENSEMBL: ENSMUSP00000015277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015277] [ENSMUST00000145954]
Predicted Effect probably damaging
Transcript: ENSMUST00000015277
AA Change: V1693A

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000015277
Gene: ENSMUSG00000015133
AA Change: V1693A

DomainStartEndE-ValueType
ANK 86 116 9.33e2 SMART
ANK 119 148 1.14e2 SMART
ANK 152 182 8.36e1 SMART
ANK 193 223 2.6e1 SMART
LRR 278 300 2.84e2 SMART
LRR 301 325 7.79e0 SMART
LRR 328 351 3.27e1 SMART
LRR_TYP 379 401 2.53e-2 SMART
LRR 403 427 5.89e1 SMART
LRR 472 493 5.27e1 SMART
LRR 548 569 2.92e2 SMART
LRR 570 594 5.88e0 SMART
Pfam:Arf 625 786 2e-8 PFAM
Pfam:Roc 640 761 3.1e-24 PFAM
Pfam:Ras 640 782 2.2e-7 PFAM
Pfam:COR 844 1046 4.7e-26 PFAM
low complexity region 1109 1119 N/A INTRINSIC
low complexity region 1209 1222 N/A INTRINSIC
Pfam:Pkinase 1243 1521 7.8e-40 PFAM
Pfam:Pkinase_Tyr 1244 1520 9.4e-39 PFAM
low complexity region 1642 1654 N/A INTRINSIC
low complexity region 1839 1846 N/A INTRINSIC
low complexity region 1852 1871 N/A INTRINSIC
low complexity region 1957 1970 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131239
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137181
Predicted Effect probably benign
Transcript: ENSMUST00000145954
SMART Domains Protein: ENSMUSP00000114938
Gene: ENSMUSG00000015133

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
low complexity region 124 137 N/A INTRINSIC
Pfam:Pkinase 158 435 6.6e-46 PFAM
Pfam:Pkinase_Tyr 159 435 5.8e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167705
Meta Mutation Damage Score 0.23 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 95% (75/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is a leucine-rich repeat kinase and a GDP/GTP binding protein. The encoded protein is thought to play a role in the regulation of bone mass. Mice lacking a similar gene showed severe osteopetrosis, increased bone mineralization and decreased bone resorption. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for another knock-out allele exhibit severe osteopetrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,773,332 V306A possibly damaging Het
9530053A07Rik C G 7: 28,155,373 P1808R probably damaging Het
Aatk T A 11: 120,010,991 S803C probably benign Het
Abcc9 C T 6: 142,679,308 A454T probably damaging Het
Abr T C 11: 76,452,332 E565G probably damaging Het
Adam33 C A 2: 131,051,346 R753L probably benign Het
Adgre1 A G 17: 57,401,955 T49A possibly damaging Het
AI314180 A T 4: 58,810,785 I1524N probably damaging Het
Ankra2 A T 13: 98,268,442 H153L probably damaging Het
Ankrd26 T G 6: 118,511,638 E1353D probably benign Het
Ankrd52 T G 10: 128,379,331 probably null Het
Arhgef10l T A 4: 140,542,757 T619S possibly damaging Het
Asgr1 T C 11: 70,056,894 V130A possibly damaging Het
Atg10 C A 13: 90,937,347 C161F probably damaging Het
Atm A T 9: 53,490,254 N1438K probably damaging Het
BC107364 T A 3: 96,436,006 probably null Het
Bcar3 G T 3: 122,426,576 A41S probably benign Het
Btbd6 A G 12: 112,977,312 probably benign Het
Cchcr1 A G 17: 35,524,703 T318A possibly damaging Het
Celsr1 A T 15: 85,925,518 I2221N probably damaging Het
Cept1 C T 3: 106,533,445 W48* probably null Het
Cfap161 T A 7: 83,793,276 I85L probably benign Het
Clasp1 A T 1: 118,512,180 R640* probably null Het
Col5a1 T A 2: 27,952,436 I441N unknown Het
Col9a1 C A 1: 24,185,405 L223I unknown Het
Dnah2 T C 11: 69,516,010 D223G probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dpy19l1 A T 9: 24,450,696 M129K possibly damaging Het
Fcrl1 C A 3: 87,389,639 H318Q probably benign Het
Fer1l5 A G 1: 36,402,531 N609S probably damaging Het
Fkbp4 C T 6: 128,433,231 E256K probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Glrx G A 13: 75,847,299 probably null Het
Gm6614 A T 6: 141,993,642 N208K possibly damaging Het
Gm7356 A T 17: 14,001,464 M101K probably damaging Het
Gstp2 A T 19: 4,040,499 I162N probably benign Het
Hectd3 A C 4: 116,999,586 K443N probably damaging Het
Hmcn1 T A 1: 150,664,784 R2925W probably damaging Het
Hspa1a G T 17: 34,970,306 N540K probably damaging Het
Ints6 A T 14: 62,700,786 M649K probably benign Het
Katnb1 T C 8: 95,095,456 V270A possibly damaging Het
Kctd3 A G 1: 188,972,364 S737P probably benign Het
Klra10 T C 6: 130,272,544 probably null Het
Lmtk3 A G 7: 45,798,589 D1353G unknown Het
Mpnd A T 17: 56,009,575 I85F probably damaging Het
Myo3b A G 2: 70,348,960 T1173A probably benign Het
Myof G A 19: 37,903,831 P1158L probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Ncor2 A G 5: 125,110,005 probably benign Het
Npepps C T 11: 97,258,273 probably null Het
Olfr1247 T G 2: 89,609,446 I219L probably damaging Het
Opn5 T A 17: 42,580,749 I266F probably benign Het
P2rx4 A G 5: 122,707,700 D16G probably damaging Het
Padi2 G T 4: 140,917,637 V61L probably benign Het
Pkd1l1 G A 11: 8,863,911 T1480I probably benign Het
Plcb1 T C 2: 135,335,451 S568P probably damaging Het
Rassf10 A G 7: 112,955,707 E505G probably damaging Het
Rcan2 A G 17: 43,836,334 E21G probably benign Het
Rhob G T 12: 8,499,585 C16* probably null Het
Ryr3 T C 2: 112,660,068 N3807S probably damaging Het
Sass6 T A 3: 116,621,397 N519K probably benign Het
Smad9 A T 3: 54,782,443 D28V probably damaging Het
Tepp A T 8: 95,321,266 probably null Het
Tex14 G T 11: 87,514,373 G704C probably benign Het
Tmc3 A G 7: 83,622,316 N892S probably benign Het
Tnfaip2 T A 12: 111,445,663 L166Q probably damaging Het
Triml2 A G 8: 43,185,128 probably null Het
Trio A G 15: 27,856,107 V666A probably benign Het
Tshz2 G T 2: 169,884,664 L393F probably damaging Het
Ttn T G 2: 76,841,771 probably benign Het
Tubb5 A G 17: 35,835,842 Y159H probably damaging Het
Umodl1 A G 17: 30,959,155 Y35C probably damaging Het
Utp4 T C 8: 106,904,446 probably null Het
Vmn1r60 A T 7: 5,544,865 C79S probably damaging Het
Wnt5b T C 6: 119,433,790 T230A probably damaging Het
Zfp618 A T 4: 63,132,706 I575F probably damaging Het
Zmym6 G T 4: 127,123,383 V894L possibly damaging Het
Zpbp T C 11: 11,462,318 probably benign Het
Other mutations in Lrrk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Lrrk1 APN 7 66287701 missense probably damaging 1.00
IGL01511:Lrrk1 APN 7 66265450 missense possibly damaging 0.48
IGL02337:Lrrk1 APN 7 66279416 missense possibly damaging 0.92
IGL02636:Lrrk1 APN 7 66308659 critical splice donor site probably null
IGL02679:Lrrk1 APN 7 66274872 missense probably damaging 1.00
IGL02711:Lrrk1 APN 7 66330767 missense probably damaging 1.00
IGL02742:Lrrk1 APN 7 66308691 missense probably benign 0.12
IGL02878:Lrrk1 APN 7 66262563 missense probably benign
IGL03135:Lrrk1 APN 7 66262890 missense probably benign 0.00
IGL03191:Lrrk1 APN 7 66259959 missense probably damaging 0.99
IGL03198:Lrrk1 APN 7 66306894 missense probably damaging 1.00
combustion UTSW 7 66262665 missense possibly damaging 0.94
Heiland UTSW 7 66262733 missense probably damaging 0.96
liebster UTSW 7 66294981 missense probably damaging 1.00
magi UTSW 7 66281648 missense probably damaging 1.00
oxidation UTSW 7 66279372 missense probably benign 0.00
phlogiston UTSW 7 66278520 splice site probably benign
savior UTSW 7 66262487 missense probably damaging 1.00
wenig UTSW 7 66273001 missense probably damaging 1.00
R0105:Lrrk1 UTSW 7 66292341 missense probably damaging 1.00
R0105:Lrrk1 UTSW 7 66292341 missense probably damaging 1.00
R0276:Lrrk1 UTSW 7 66296263 splice site probably benign
R0505:Lrrk1 UTSW 7 66290908 splice site probably null
R0609:Lrrk1 UTSW 7 66266615 splice site probably null
R0650:Lrrk1 UTSW 7 66292336 missense probably damaging 1.00
R0676:Lrrk1 UTSW 7 66294981 missense probably damaging 1.00
R1157:Lrrk1 UTSW 7 66262283 missense probably benign 0.00
R1435:Lrrk1 UTSW 7 66273028 missense probably damaging 1.00
R1468:Lrrk1 UTSW 7 66259974 missense probably damaging 1.00
R1468:Lrrk1 UTSW 7 66259974 missense probably damaging 1.00
R1498:Lrrk1 UTSW 7 66302671 nonsense probably null
R1620:Lrrk1 UTSW 7 66381538 missense probably benign 0.00
R1884:Lrrk1 UTSW 7 66262437 missense probably benign
R1891:Lrrk1 UTSW 7 66279300 missense probably damaging 1.00
R1989:Lrrk1 UTSW 7 66281684 missense probably damaging 1.00
R2107:Lrrk1 UTSW 7 66279282 missense probably damaging 1.00
R2140:Lrrk1 UTSW 7 66330750 missense probably damaging 1.00
R2144:Lrrk1 UTSW 7 66296163 missense probably damaging 0.98
R2147:Lrrk1 UTSW 7 66285411 splice site probably null
R3176:Lrrk1 UTSW 7 66305521 missense possibly damaging 0.69
R3276:Lrrk1 UTSW 7 66305521 missense possibly damaging 0.69
R3886:Lrrk1 UTSW 7 66292364 missense probably damaging 1.00
R3893:Lrrk1 UTSW 7 66278520 splice site probably benign
R3906:Lrrk1 UTSW 7 66294903 missense possibly damaging 0.84
R4259:Lrrk1 UTSW 7 66330764 missense probably damaging 1.00
R4649:Lrrk1 UTSW 7 66273053 missense probably benign 0.12
R4653:Lrrk1 UTSW 7 66273053 missense probably benign 0.12
R4672:Lrrk1 UTSW 7 66279372 missense probably benign 0.00
R4693:Lrrk1 UTSW 7 66262487 missense probably damaging 1.00
R4729:Lrrk1 UTSW 7 66262293 missense probably benign
R4737:Lrrk1 UTSW 7 66306873 missense probably benign 0.09
R4795:Lrrk1 UTSW 7 66262665 missense possibly damaging 0.94
R4911:Lrrk1 UTSW 7 66295454 missense probably damaging 0.97
R5002:Lrrk1 UTSW 7 66332363 missense probably damaging 1.00
R5254:Lrrk1 UTSW 7 66307107 missense probably benign 0.00
R5407:Lrrk1 UTSW 7 66270797 missense probably benign 0.20
R5482:Lrrk1 UTSW 7 66330670 missense probably benign
R5600:Lrrk1 UTSW 7 66307215 missense probably benign 0.31
R5615:Lrrk1 UTSW 7 66287615 missense probably damaging 1.00
R6041:Lrrk1 UTSW 7 66262133 missense probably benign
R6211:Lrrk1 UTSW 7 66302710 missense possibly damaging 0.89
R6271:Lrrk1 UTSW 7 66307103 critical splice donor site probably null
R6276:Lrrk1 UTSW 7 66306839 splice site probably null
R6447:Lrrk1 UTSW 7 66302728 missense probably benign 0.19
R6615:Lrrk1 UTSW 7 66281648 missense probably damaging 1.00
R6745:Lrrk1 UTSW 7 66273001 missense probably damaging 1.00
R6836:Lrrk1 UTSW 7 66342779 missense probably benign 0.05
R6995:Lrrk1 UTSW 7 66292342 missense probably damaging 1.00
R7107:Lrrk1 UTSW 7 66287443 missense possibly damaging 0.94
R7137:Lrrk1 UTSW 7 66285279 missense probably benign 0.06
R7203:Lrrk1 UTSW 7 66270825 missense probably damaging 1.00
R7224:Lrrk1 UTSW 7 66332386 missense probably damaging 0.99
R7239:Lrrk1 UTSW 7 66262155 missense probably benign
R7440:Lrrk1 UTSW 7 66290854 missense probably damaging 1.00
R7515:Lrrk1 UTSW 7 66262562 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAATTGGCCTTGTCGTCGAG -3'
(R):5'- AAGAATATTGTGTGTCCCTGTCC -3'

Sequencing Primer
(F):5'- TTGTCGTCGAGGCACCAGAC -3'
(R):5'- AATATTGTGTGTCCCTGTCCCTTCC -3'
Posted On2018-05-21