Mutagenetix > Incidental Mutations

Incidental Mutation 'R6478:Celsr1'

516938

Institutional Source

Beutler Lab

Gene Symbol

Celsr1

Ensembl Gene

ENSMUSG00000016028

Gene Name

cadherin, EGF LAG seven-pass G-type receptor 1

Synonyms

crash, Crsh, Scy

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.860) question?

Stock #

R6478 (G1)

Quality Score

202.009

Status

Validated

Chromosome

Chromosomal Location

85898929-86033777 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 85925518 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 2221 (I2221N)

Ref Sequence

ENSEMBL: ENSMUSP00000016172 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000016172]

Predicted Effect

probably damaging
Transcript: ENSMUST00000016172
AA Change: I2221N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000016172
Gene: ENSMUSG00000016028
AA Change: I2221N

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
low complexity region	65	93	N/A	INTRINSIC
low complexity region	221	240	N/A	INTRINSIC
low complexity region	243	257	N/A	INTRINSIC
CA	282	366	9.51e-26	SMART
CA	390	472	1.59e-27	SMART
CA	496	578	3.8e-25	SMART
CA	602	700	2.25e-27	SMART
CA	724	802	3.14e-17	SMART
CA	826	905	2.67e-29	SMART
CA	929	1012	3.23e-28	SMART
CA	1036	1114	4.17e-22	SMART
CA	1142	1218	6.89e-1	SMART
EGF	1321	1376	3.38e-3	SMART
EGF	1381	1414	5.49e-3	SMART
EGF	1421	1456	9.7e-4	SMART
LamG	1477	1644	2.53e-33	SMART
EGF	1667	1700	6.4e-4	SMART
LamG	1726	1864	1.13e-21	SMART
EGF	1890	1923	1.84e-4	SMART
EGF	1925	1961	5.49e-3	SMART
EGF_Lam	2018	2063	7.12e-11	SMART
HormR	2066	2128	2.55e-20	SMART
Pfam:GAIN	2140	2396	1.1e-64	PFAM
GPS	2422	2475	5.03e-22	SMART
Pfam:7tm_2	2480	2712	2.6e-60	PFAM
low complexity region	2738	2753	N/A	INTRINSIC
low complexity region	2819	2852	N/A	INTRINSIC
low complexity region	2976	2988	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000226840
AA Change: I854N

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227450

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.3%

Validation Efficiency

95% (75/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. This particular member is a developmentally regulated, neural-specific gene which plays an unspecified role in early embryogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit kinky tails, variable neural tube defects, abnormal hair follicle orientation, whorl-like hair patterns, and partial prenatal lethality. ENU-induced mutants show defects in planar polarity of inner ear hair cells and complete perinatal lethality due to craniorachischisis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	A	G	14: 49,773,332	V306A	possibly damaging	Het
9530053A07Rik	C	G	7: 28,155,373	P1808R	probably damaging	Het
Aatk	T	A	11: 120,010,991	S803C	probably benign	Het
Abcc9	C	T	6: 142,679,308	A454T	probably damaging	Het
Abr	T	C	11: 76,452,332	E565G	probably damaging	Het
Adam33	C	A	2: 131,051,346	R753L	probably benign	Het
Adgre1	A	G	17: 57,401,955	T49A	possibly damaging	Het
AI314180	A	T	4: 58,810,785	I1524N	probably damaging	Het
Ankra2	A	T	13: 98,268,442	H153L	probably damaging	Het
Ankrd26	T	G	6: 118,511,638	E1353D	probably benign	Het
Ankrd52	T	G	10: 128,379,331		probably null	Het
Arhgef10l	T	A	4: 140,542,757	T619S	possibly damaging	Het
Asgr1	T	C	11: 70,056,894	V130A	possibly damaging	Het
Atg10	C	A	13: 90,937,347	C161F	probably damaging	Het
Atm	A	T	9: 53,490,254	N1438K	probably damaging	Het
BC107364	T	A	3: 96,436,006		probably null	Het
Bcar3	G	T	3: 122,426,576	A41S	probably benign	Het
Btbd6	A	G	12: 112,977,312		probably benign	Het
Cchcr1	A	G	17: 35,524,703	T318A	possibly damaging	Het
Cept1	C	T	3: 106,533,445	W48*	probably null	Het
Cfap161	T	A	7: 83,793,276	I85L	probably benign	Het
Clasp1	A	T	1: 118,512,180	R640*	probably null	Het
Col5a1	T	A	2: 27,952,436	I441N	unknown	Het
Col9a1	C	A	1: 24,185,405	L223I	unknown	Het
Dnah2	T	C	11: 69,516,010	D223G	probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Dpy19l1	A	T	9: 24,450,696	M129K	possibly damaging	Het
Fcrl1	C	A	3: 87,389,639	H318Q	probably benign	Het
Fer1l5	A	G	1: 36,402,531	N609S	probably damaging	Het
Fkbp4	C	T	6: 128,433,231	E256K	probably damaging	Het
Fsip2	A	G	2: 82,990,086	T5388A	possibly damaging	Het
Glrx	G	A	13: 75,847,299		probably null	Het
Gm6614	A	T	6: 141,993,642	N208K	possibly damaging	Het
Gm7356	A	T	17: 14,001,464	M101K	probably damaging	Het
Gstp2	A	T	19: 4,040,499	I162N	probably benign	Het
Hectd3	A	C	4: 116,999,586	K443N	probably damaging	Het
Hmcn1	T	A	1: 150,664,784	R2925W	probably damaging	Het
Hspa1a	G	T	17: 34,970,306	N540K	probably damaging	Het
Ints6	A	T	14: 62,700,786	M649K	probably benign	Het
Katnb1	T	C	8: 95,095,456	V270A	possibly damaging	Het
Kctd3	A	G	1: 188,972,364	S737P	probably benign	Het
Klra10	T	C	6: 130,272,544		probably null	Het
Lmtk3	A	G	7: 45,798,589	D1353G	unknown	Het
Lrrk1	A	G	7: 66,262,733	V1693A	probably damaging	Het
Mpnd	A	T	17: 56,009,575	I85F	probably damaging	Het
Myo3b	A	G	2: 70,348,960	T1173A	probably benign	Het
Myof	G	A	19: 37,903,831	P1158L	probably damaging	Het
Naip2	A	C	13: 100,162,041	S496A	probably benign	Het
Ncor2	A	G	5: 125,110,005		probably benign	Het
Npepps	C	T	11: 97,258,273		probably null	Het
Olfr1247	T	G	2: 89,609,446	I219L	probably damaging	Het
Opn5	T	A	17: 42,580,749	I266F	probably benign	Het
P2rx4	A	G	5: 122,707,700	D16G	probably damaging	Het
Padi2	G	T	4: 140,917,637	V61L	probably benign	Het
Pkd1l1	G	A	11: 8,863,911	T1480I	probably benign	Het
Plcb1	T	C	2: 135,335,451	S568P	probably damaging	Het
Rassf10	A	G	7: 112,955,707	E505G	probably damaging	Het
Rcan2	A	G	17: 43,836,334	E21G	probably benign	Het
Rhob	G	T	12: 8,499,585	C16*	probably null	Het
Ryr3	T	C	2: 112,660,068	N3807S	probably damaging	Het
Sass6	T	A	3: 116,621,397	N519K	probably benign	Het
Smad9	A	T	3: 54,782,443	D28V	probably damaging	Het
Tepp	A	T	8: 95,321,266		probably null	Het
Tex14	G	T	11: 87,514,373	G704C	probably benign	Het
Tmc3	A	G	7: 83,622,316	N892S	probably benign	Het
Tnfaip2	T	A	12: 111,445,663	L166Q	probably damaging	Het
Triml2	A	G	8: 43,185,128		probably null	Het
Trio	A	G	15: 27,856,107	V666A	probably benign	Het
Tshz2	G	T	2: 169,884,664	L393F	probably damaging	Het
Ttn	T	G	2: 76,841,771		probably benign	Het
Tubb5	A	G	17: 35,835,842	Y159H	probably damaging	Het
Umodl1	A	G	17: 30,959,155	Y35C	probably damaging	Het
Utp4	T	C	8: 106,904,446		probably null	Het
Vmn1r60	A	T	7: 5,544,865	C79S	probably damaging	Het
Wnt5b	T	C	6: 119,433,790	T230A	probably damaging	Het
Zfp618	A	T	4: 63,132,706	I575F	probably damaging	Het
Zmym6	G	T	4: 127,123,383	V894L	possibly damaging	Het
Zpbp	T	C	11: 11,462,318		probably benign	Het

Other mutations in Celsr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Celsr1	APN	15	85931345	missense	probably benign	0.04
IGL00519:Celsr1	APN	15	86030836	missense	probably damaging	1.00
IGL00909:Celsr1	APN	15	85922235	missense	probably damaging	1.00
IGL01303:Celsr1	APN	15	86030491	missense	probably damaging	0.97
IGL01726:Celsr1	APN	15	85926190	missense	probably benign	0.35
IGL01910:Celsr1	APN	15	85929895	missense	probably benign
IGL01931:Celsr1	APN	15	85907660	missense	probably damaging	1.00
IGL01952:Celsr1	APN	15	85963223	missense	probably benign	0.35
IGL02090:Celsr1	APN	15	85907721	missense	possibly damaging	0.49
IGL02191:Celsr1	APN	15	85979004	missense	possibly damaging	0.69
IGL02372:Celsr1	APN	15	85929907	missense	probably benign	0.01
IGL02413:Celsr1	APN	15	86031226	missense	possibly damaging	0.96
IGL02478:Celsr1	APN	15	85941136	missense	possibly damaging	0.68
IGL02507:Celsr1	APN	15	85900688	utr 3 prime	probably benign
IGL02508:Celsr1	APN	15	86030617	nonsense	probably null
IGL02899:Celsr1	APN	15	86031726	missense	probably damaging	0.98
IGL02939:Celsr1	APN	15	85901472	missense	probably benign
IGL03212:Celsr1	APN	15	85930677	missense	probably benign	0.04
P0028:Celsr1	UTSW	15	85922235	missense	probably damaging	1.00
PIT4305001:Celsr1	UTSW	15	85900937	missense	possibly damaging	0.87
PIT4480001:Celsr1	UTSW	15	86032414	missense	probably damaging	0.99
R0018:Celsr1	UTSW	15	86031042	missense	possibly damaging	0.47
R0018:Celsr1	UTSW	15	86031042	missense	possibly damaging	0.47
R0038:Celsr1	UTSW	15	85929419	missense	possibly damaging	0.65
R0057:Celsr1	UTSW	15	86030762	missense	probably benign	0.02
R0060:Celsr1	UTSW	15	85922198	missense	probably damaging	0.98
R0060:Celsr1	UTSW	15	85922198	missense	probably damaging	0.98
R0279:Celsr1	UTSW	15	85902864	missense	probably benign	0.00
R0570:Celsr1	UTSW	15	85903365	missense	probably benign	0.18
R0611:Celsr1	UTSW	15	85932323	missense	possibly damaging	0.91
R0731:Celsr1	UTSW	15	85901597	missense	probably benign
R0792:Celsr1	UTSW	15	85931276	missense	probably benign	0.02
R0943:Celsr1	UTSW	15	85903288	missense	probably damaging	1.00
R0989:Celsr1	UTSW	15	86031279	missense	probably benign	0.39
R1118:Celsr1	UTSW	15	86032047	missense	probably damaging	1.00
R1237:Celsr1	UTSW	15	85903974	missense	probably benign	0.01
R1239:Celsr1	UTSW	15	85979146	missense	probably damaging	0.99
R1405:Celsr1	UTSW	15	85905434	splice site	probably null
R1405:Celsr1	UTSW	15	85905434	splice site	probably null
R1522:Celsr1	UTSW	15	85931276	missense	probably benign	0.02
R1662:Celsr1	UTSW	15	86031062	missense	probably damaging	1.00
R1673:Celsr1	UTSW	15	85932457	missense	probably benign	0.00
R1795:Celsr1	UTSW	15	86030323	missense	probably damaging	0.99
R1799:Celsr1	UTSW	15	86032685	missense	probably damaging	1.00
R1858:Celsr1	UTSW	15	86032759	missense	probably damaging	1.00
R2040:Celsr1	UTSW	15	86032887	missense	probably damaging	1.00
R2050:Celsr1	UTSW	15	86030547	missense	probably benign	0.02
R2131:Celsr1	UTSW	15	85963223	missense	probably benign	0.35
R2132:Celsr1	UTSW	15	86031967	missense	possibly damaging	0.91
R2189:Celsr1	UTSW	15	85979230	missense	possibly damaging	0.93
R2192:Celsr1	UTSW	15	85916723	missense	possibly damaging	0.93
R4213:Celsr1	UTSW	15	86031807	missense	probably damaging	1.00
R4356:Celsr1	UTSW	15	85978827	missense	probably damaging	1.00
R4414:Celsr1	UTSW	15	85963133	missense	probably benign	0.00
R4414:Celsr1	UTSW	15	85927999	missense	probably damaging	1.00
R4416:Celsr1	UTSW	15	85927999	missense	probably damaging	1.00
R4645:Celsr1	UTSW	15	85916756	missense	probably benign	0.35
R4666:Celsr1	UTSW	15	86030494	missense	probably damaging	1.00
R4687:Celsr1	UTSW	15	85932460	missense	possibly damaging	0.94
R4735:Celsr1	UTSW	15	85906029	critical splice acceptor site	probably null
R4804:Celsr1	UTSW	15	85937953	missense	possibly damaging	0.49
R4995:Celsr1	UTSW	15	85937911	missense	probably damaging	0.99
R5070:Celsr1	UTSW	15	85939134	missense	possibly damaging	0.89
R5218:Celsr1	UTSW	15	85932384	missense	probably damaging	1.00
R5280:Celsr1	UTSW	15	85930546	missense	probably benign
R5310:Celsr1	UTSW	15	85926222	missense	possibly damaging	0.88
R5388:Celsr1	UTSW	15	85925518	missense	probably damaging	0.99
R5484:Celsr1	UTSW	15	85931282	missense	probably benign	0.00
R5639:Celsr1	UTSW	15	86030767	missense	probably damaging	1.00
R5758:Celsr1	UTSW	15	85941264	missense	probably benign	0.27
R5778:Celsr1	UTSW	15	86032955	missense	probably damaging	1.00
R5893:Celsr1	UTSW	15	85904014	missense	probably benign	0.02
R5915:Celsr1	UTSW	15	85937975	missense	probably benign
R5915:Celsr1	UTSW	15	86030349	missense	probably damaging	0.96
R5932:Celsr1	UTSW	15	86032704	missense	probably damaging	1.00
R5950:Celsr1	UTSW	15	86032500	missense	probably damaging	1.00
R5975:Celsr1	UTSW	15	85919038	splice site	probably null
R6050:Celsr1	UTSW	15	85930611	missense	probably benign	0.00
R6117:Celsr1	UTSW	15	85932411	missense	probably benign	0.04
R6178:Celsr1	UTSW	15	85901021	missense	probably benign	0.08
R6186:Celsr1	UTSW	15	85921193	missense	possibly damaging	0.84
R6212:Celsr1	UTSW	15	85916687	missense	probably benign	0.25
R6307:Celsr1	UTSW	15	85928330	missense	probably benign
R6320:Celsr1	UTSW	15	85900959	missense	probably benign	0.13
R6349:Celsr1	UTSW	15	86031684	missense	probably damaging	1.00
R6504:Celsr1	UTSW	15	85978920	missense	probably benign	0.07
R6607:Celsr1	UTSW	15	85963285	missense	probably benign
R6615:Celsr1	UTSW	15	85902114	critical splice donor site	probably null
R6661:Celsr1	UTSW	15	85918934	missense	probably damaging	1.00
R6722:Celsr1	UTSW	15	85905914	critical splice donor site	probably null
R6743:Celsr1	UTSW	15	85907598	missense	probably damaging	0.96
R6746:Celsr1	UTSW	15	86031495	missense	probably damaging	1.00
R6772:Celsr1	UTSW	15	86030782	missense	probably benign
R6838:Celsr1	UTSW	15	85939194	missense	probably benign
R6886:Celsr1	UTSW	15	86031654	missense	probably benign	0.00
R7030:Celsr1	UTSW	15	85905478	missense	probably damaging	0.99
R7060:Celsr1	UTSW	15	86032655	missense	probably benign	0.07
R7080:Celsr1	UTSW	15	85932451	missense	possibly damaging	0.87
R7325:Celsr1	UTSW	15	86033008	missense	probably damaging	0.99
R7357:Celsr1	UTSW	15	86030514	missense	probably benign	0.00
R7371:Celsr1	UTSW	15	86030674	missense	possibly damaging	0.91
R7446:Celsr1	UTSW	15	85907673	missense	possibly damaging	0.95
R7465:Celsr1	UTSW	15	86033392	missense	probably benign
R7491:Celsr1	UTSW	15	86032518	missense	possibly damaging	0.78
R7639:Celsr1	UTSW	15	85929872	missense	probably benign	0.00
R7685:Celsr1	UTSW	15	85978732	nonsense	probably null
R7741:Celsr1	UTSW	15	85979102	missense	possibly damaging	0.94
R7768:Celsr1	UTSW	15	85932409	missense	probably benign
R7974:Celsr1	UTSW	15	86031030	missense	probably damaging	1.00
R7977:Celsr1	UTSW	15	86032993	missense	probably damaging	1.00
R7987:Celsr1	UTSW	15	86032993	missense	probably damaging	1.00
R8073:Celsr1	UTSW	15	85939155	missense	probably benign	0.00
R8099:Celsr1	UTSW	15	86031600	missense	probably damaging	0.99
R8190:Celsr1	UTSW	15	85902889	missense	probably damaging	0.99
R8210:Celsr1	UTSW	15	85979235	missense	probably benign	0.00
R8289:Celsr1	UTSW	15	86033085	nonsense	probably null
R8290:Celsr1	UTSW	15	86033085	nonsense	probably null
R8292:Celsr1	UTSW	15	85907618	missense	possibly damaging	0.90
R8328:Celsr1	UTSW	15	85922244	missense	probably benign	0.00
R8330:Celsr1	UTSW	15	85932300	missense	probably damaging	0.99
R8333:Celsr1	UTSW	15	86031414	missense	possibly damaging	0.65
R8352:Celsr1	UTSW	15	86033085	nonsense	probably null
R8384:Celsr1	UTSW	15	86033085	nonsense	probably null
R8452:Celsr1	UTSW	15	86033085	nonsense	probably null
R8463:Celsr1	UTSW	15	86030214	missense	probably damaging	1.00
R8479:Celsr1	UTSW	15	86033085	nonsense	probably null
R8480:Celsr1	UTSW	15	86033085	nonsense	probably null
R8493:Celsr1	UTSW	15	85938006	missense	possibly damaging	0.67
R8498:Celsr1	UTSW	15	85939105	missense	probably benign	0.01
R8506:Celsr1	UTSW	15	86033085	nonsense	probably null
Z1176:Celsr1	UTSW	15	85963100	missense	probably damaging	0.96
Z1177:Celsr1	UTSW	15	85978851	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCTCACTTTTCTACAGACTGC -3'
(R):5'- GTCACTTCATGGCTGTCTAGAAG -3'

Sequencing Primer
(F):5'- ACCCACGTCACTGTTGGG -3'
(R):5'- AGAAGGTATTTTCCTCTACCTCAGG -3'

Posted On

2018-05-21