Mutagenetix > Incidental Mutations

Incidental Mutation 'R6479:Plch1'

516963

Institutional Source

Beutler Lab

Gene Symbol

Plch1

Ensembl Gene

ENSMUSG00000036834

Gene Name

phospholipase C, eta 1

Synonyms

PLCeta1, Plcl3

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.171) question?

Stock #

R6479 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

63696234-63899472 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 63744510 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 387 (T387A)

Ref Sequence

ENSEMBL: ENSMUSP00000135424 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048134] [ENSMUST00000059973] [ENSMUST00000084105] [ENSMUST00000159676] [ENSMUST00000160638] [ENSMUST00000162269] [ENSMUST00000175947] [ENSMUST00000177143]

Predicted Effect

probably benign
Transcript: ENSMUST00000048134
AA Change: T357A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000047693
Gene: ENSMUSG00000036834
AA Change: T357A

Domain	Start	End	E-Value	Type
PH	3	112	2.37e-6	SMART
EFh	128	156	2.41e-4	SMART
EFh	164	193	1.54e-2	SMART
Pfam:EF-hand_like	198	280	2.2e-26	PFAM
PLCXc	281	426	3.13e-71	SMART
low complexity region	440	453	N/A	INTRINSIC
low complexity region	564	581	N/A	INTRINSIC
PLCYc	583	696	3.4e-49	SMART
C2	715	823	5.47e-22	SMART
low complexity region	979	997	N/A	INTRINSIC
low complexity region	1079	1091	N/A	INTRINSIC
low complexity region	1420	1435	N/A	INTRINSIC
low complexity region	1543	1557	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000059973
AA Change: T375A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000058524
Gene: ENSMUSG00000036834
AA Change: T375A

Domain	Start	End	E-Value	Type
PH	21	130	1.1e-8	SMART
EFh	146	174	1.1e-6	SMART
EFh	182	211	7.6e-5	SMART
Pfam:EF-hand_like	216	298	4.5e-24	PFAM
PLCXc	299	444	1.6e-73	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	582	599	N/A	INTRINSIC
PLCYc	601	714	1.7e-51	SMART
C2	733	841	3.7e-24	SMART
low complexity region	1017	1035	N/A	INTRINSIC
low complexity region	1117	1129	N/A	INTRINSIC
low complexity region	1458	1473	N/A	INTRINSIC
low complexity region	1581	1595	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000084105
AA Change: T375A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000081122
Gene: ENSMUSG00000036834
AA Change: T375A

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	2.4e-27	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	583	600	N/A	INTRINSIC
PLCYc	602	715	3.4e-49	SMART
C2	734	842	5.47e-22	SMART
low complexity region	1018	1036	N/A	INTRINSIC
low complexity region	1118	1130	N/A	INTRINSIC
low complexity region	1459	1474	N/A	INTRINSIC
low complexity region	1582	1596	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159676
AA Change: T375A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000124632
Gene: ENSMUSG00000036834
AA Change: T375A

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	1.8e-26	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	583	600	N/A	INTRINSIC
PLCYc	602	715	3.4e-49	SMART
C2	734	842	5.47e-22	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159982

Predicted Effect

probably benign
Transcript: ENSMUST00000160638
AA Change: T375A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000123921
Gene: ENSMUSG00000036834
AA Change: T375A

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	5.3e-28	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	583	600	N/A	INTRINSIC
PLCYc	602	715	3.4e-49	SMART
C2	734	842	5.47e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000162269
AA Change: T375A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000124463
Gene: ENSMUSG00000036834
AA Change: T375A

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	1.7e-26	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	583	600	N/A	INTRINSIC
PLCYc	602	715	3.4e-49	SMART
C2	734	842	5.47e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000175947
AA Change: T375A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000135353
Gene: ENSMUSG00000036834
AA Change: T375A

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	1.2e-26	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	582	599	N/A	INTRINSIC
PLCYc	601	714	3.4e-49	SMART
C2	733	841	5.47e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000177143
AA Change: T387A

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000135424
Gene: ENSMUSG00000036834
AA Change: T387A

Domain	Start	End	E-Value	Type
PH	33	142	2.37e-6	SMART
EFh	158	186	2.41e-4	SMART
EFh	194	223	1.54e-2	SMART
Pfam:EF-hand_like	228	310	2.3e-26	PFAM
PLCXc	311	456	3.13e-71	SMART
low complexity region	470	483	N/A	INTRINSIC
low complexity region	594	611	N/A	INTRINSIC
PLCYc	613	726	3.4e-49	SMART
C2	745	853	5.47e-22	SMART
low complexity region	1009	1027	N/A	INTRINSIC
low complexity region	1109	1121	N/A	INTRINSIC
low complexity region	1450	1465	N/A	INTRINSIC
low complexity region	1573	1587	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.7%
20x: 92.0%

Validation Efficiency

95% (55/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PLCH1 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2) to generate second messengers inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) (Hwang et al., 2005 [PubMed 15702972]).[supplied by OMIM, Jun 2009]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam18	A	C	8: 24,629,665	S533A	probably benign	Het
Akap6	T	G	12: 53,141,169	S1789A	probably damaging	Het
Alox15	A	G	11: 70,345,185	S519P	probably damaging	Het
Anapc2	A	G	2: 25,285,395	K816E	probably benign	Het
Atp6v1a	T	C	16: 44,098,758	D488G	probably benign	Het
Banp	A	G	8: 121,991,437		probably null	Het
Camsap1	A	G	2: 25,935,862	C1367R	possibly damaging	Het
Casz1	C	A	4: 148,937,078	H539Q	probably damaging	Het
Ccl5	A	G	11: 83,530,386	Y26H	probably benign	Het
Cops3	A	T	11: 59,833,072	S86R	probably benign	Het
Cts7	A	G	13: 61,355,641	S170P	probably benign	Het
Cxcl15	A	T	5: 90,795,245	E35D	possibly damaging	Het
Dennd1b	C	T	1: 139,041,960		probably benign	Het
Dicer1	T	C	12: 104,696,723	D1533G	probably damaging	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Dock4	A	G	12: 40,828,955	E1531G	probably damaging	Het
Erap1	A	G	13: 74,663,493		probably null	Het
Fsip2	A	G	2: 82,990,086	T5388A	possibly damaging	Het
Gab1	C	A	8: 80,788,597	R364L	possibly damaging	Het
Gm10309	A	T	17: 86,504,579	M1K	probably null	Het
Gm21994	C	T	2: 150,254,591	G306D	probably damaging	Het
Gm4450	T	A	3: 98,446,841	E114V	possibly damaging	Het
Gm4884	A	T	7: 41,040,787	N36Y	probably damaging	Het
Hmcn1	G	A	1: 150,677,302	R2546*	probably null	Het
Hmcn2	A	G	2: 31,425,468	D3743G	probably damaging	Het
Irak2	A	T	6: 113,686,941	N423Y	probably damaging	Het
Jarid2	G	A	13: 44,848,289	G26D	probably benign	Het
Kif13b	A	G	14: 64,751,525	K785R	probably benign	Het
Lamc3	A	T	2: 31,887,401	I20F	probably benign	Het
Limk1	G	A	5: 134,661,519		probably benign	Het
Lrp4	C	T	2: 91,487,084	T851I	probably damaging	Het
Med13	G	A	11: 86,357,527		probably benign	Het
Megf10	T	C	18: 57,246,570	F273L	possibly damaging	Het
Meltf	T	A	16: 31,881,882	D73E	probably damaging	Het
Mroh7	A	G	4: 106,703,188	F640L	possibly damaging	Het
Mtor	T	C	4: 148,551,000	S2448P	probably benign	Het
Myo3a	T	C	2: 22,577,865	V377A	probably benign	Het
Myo5b	T	C	18: 74,617,015	V183A	probably damaging	Het
Nedd4l	G	A	18: 65,209,681	R755H	probably damaging	Het
Nrde2	T	C	12: 100,143,948	T275A	probably benign	Het
Olfr658	A	G	7: 104,645,126	I80T	probably benign	Het
Osgepl1	T	C	1: 53,321,543	V381A	probably benign	Het
Pcdha1	C	T	18: 36,931,456	T391I	probably benign	Het
Pdp1	T	C	4: 11,961,327	N328S	probably damaging	Het
Pepd	A	G	7: 35,040,722	E340G	probably benign	Het
Plxnb1	C	A	9: 109,111,665	T1536K	possibly damaging	Het
Rbp7	T	C	4: 149,449,890	T130A	probably benign	Het
Rhot2	A	T	17: 25,841,080	V309E	probably benign	Het
Slc37a1	A	G	17: 31,338,990	I421M	possibly damaging	Het
Slit2	T	A	5: 48,231,989	L585H	probably damaging	Het
Spint4	C	A	2: 164,700,844	A119D	probably benign	Het
Strip2	G	T	6: 29,944,497		probably null	Het
Stxbp4	T	C	11: 90,619,187	Y59C	probably damaging	Het
Syne1	G	A	10: 5,231,679	Q4219*	probably null	Het
Syne1	A	T	10: 5,456,826	I37N	probably damaging	Het
Syne4	G	T	7: 30,316,915	G179*	probably null	Het
Tead1	T	C	7: 112,861,465	V192A	probably benign	Het
Trim37	G	T	11: 87,216,487	E317*	probably null	Het
Wdfy3	A	C	5: 101,913,179	Y1390D	probably damaging	Het
Wdr81	A	G	11: 75,452,105	F779L	possibly damaging	Het

Other mutations in Plch1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01397:Plch1	APN	3	63731729	splice site	probably null
IGL01542:Plch1	APN	3	63731649	missense	probably damaging	0.99
IGL01999:Plch1	APN	3	63753307	missense	probably damaging	1.00
IGL02153:Plch1	APN	3	63781351	missense	probably damaging	1.00
IGL02203:Plch1	APN	3	63698739	missense	possibly damaging	0.46
IGL02220:Plch1	APN	3	63698961	missense	probably damaging	0.97
IGL02259:Plch1	APN	3	63722749	critical splice donor site	probably null
IGL02268:Plch1	APN	3	63699283	makesense	probably null
IGL02411:Plch1	APN	3	63697756	unclassified	probably null
IGL02472:Plch1	APN	3	63701849	missense	probably damaging	1.00
IGL02477:Plch1	APN	3	63753293	missense	probably damaging	1.00
IGL02503:Plch1	APN	3	63697864	missense	probably damaging	1.00
IGL02800:Plch1	APN	3	63698478	missense	probably benign	0.21
IGL03167:Plch1	APN	3	63722744	splice site	probably benign
IGL03182:Plch1	APN	3	63702594	nonsense	probably null
IGL03197:Plch1	APN	3	63753170	missense	probably damaging	1.00
IGL03251:Plch1	APN	3	63784002	missense	possibly damaging	0.93
R0335:Plch1	UTSW	3	63710978	missense	probably damaging	1.00
R0347:Plch1	UTSW	3	63753316	missense	probably damaging	1.00
R0631:Plch1	UTSW	3	63699219	missense	probably benign	0.23
R0687:Plch1	UTSW	3	63716029	missense	probably damaging	1.00
R0738:Plch1	UTSW	3	63702553	intron	probably benign
R0883:Plch1	UTSW	3	63753256	missense	probably damaging	1.00
R1437:Plch1	UTSW	3	63697533	missense	probably benign	0.37
R1678:Plch1	UTSW	3	63740694	missense	probably damaging	1.00
R1738:Plch1	UTSW	3	63719238	missense	probably benign	0.12
R1929:Plch1	UTSW	3	63744535	missense	probably damaging	1.00
R1955:Plch1	UTSW	3	63755267	missense	probably damaging	0.98
R2078:Plch1	UTSW	3	63701943	missense	probably benign	0.01
R2112:Plch1	UTSW	3	63722806	missense	probably damaging	1.00
R2158:Plch1	UTSW	3	63721234	missense	probably benign	0.00
R2165:Plch1	UTSW	3	63698482	missense	probably benign	0.01
R2259:Plch1	UTSW	3	63697977	missense	possibly damaging	0.94
R2271:Plch1	UTSW	3	63744535	missense	probably damaging	1.00
R3110:Plch1	UTSW	3	63709531	missense	probably damaging	1.00
R3112:Plch1	UTSW	3	63709531	missense	probably damaging	1.00
R3407:Plch1	UTSW	3	63699347	unclassified	probably benign
R3408:Plch1	UTSW	3	63699347	unclassified	probably benign
R3791:Plch1	UTSW	3	63699523	missense	probably benign
R3793:Plch1	UTSW	3	63697831	missense	probably damaging	0.96
R3928:Plch1	UTSW	3	63767623	missense	probably damaging	1.00
R4211:Plch1	UTSW	3	63711219	missense	probably damaging	1.00
R4212:Plch1	UTSW	3	63870759	start gained	probably benign
R4223:Plch1	UTSW	3	63701900	missense	probably damaging	1.00
R4491:Plch1	UTSW	3	63740739	missense	probably damaging	1.00
R4589:Plch1	UTSW	3	63781507	missense	probably damaging	1.00
R4656:Plch1	UTSW	3	63704177	missense	probably damaging	1.00
R4701:Plch1	UTSW	3	63699496	intron	probably null
R4716:Plch1	UTSW	3	63781546	missense	probably damaging	1.00
R4772:Plch1	UTSW	3	63753325	missense	probably damaging	1.00
R4902:Plch1	UTSW	3	63740843	intron	probably benign
R5058:Plch1	UTSW	3	63722781	missense	probably damaging	1.00
R5092:Plch1	UTSW	3	63698710	missense	probably benign	0.02
R5093:Plch1	UTSW	3	63773715	missense	probably damaging	0.99
R5210:Plch1	UTSW	3	63699778	critical splice donor site	probably null
R5368:Plch1	UTSW	3	63701973	missense	possibly damaging	0.82
R5373:Plch1	UTSW	3	63698078	missense	probably benign	0.01
R5374:Plch1	UTSW	3	63698078	missense	probably benign	0.01
R5501:Plch1	UTSW	3	63707741	missense	probably damaging	1.00
R5606:Plch1	UTSW	3	63740687	missense	probably benign	0.35
R5738:Plch1	UTSW	3	63773655	missense	probably damaging	1.00
R5835:Plch1	UTSW	3	63697522	missense	probably benign
R6106:Plch1	UTSW	3	63702023	missense	probably damaging	1.00
R6107:Plch1	UTSW	3	63702023	missense	probably damaging	1.00
R6108:Plch1	UTSW	3	63702023	missense	probably damaging	1.00
R6110:Plch1	UTSW	3	63698858	missense	possibly damaging	0.62
R6116:Plch1	UTSW	3	63702023	missense	probably damaging	1.00
R6147:Plch1	UTSW	3	63722881	missense	probably damaging	1.00
R6195:Plch1	UTSW	3	63740789	missense	probably damaging	1.00
R6315:Plch1	UTSW	3	63781390	nonsense	probably null
R6316:Plch1	UTSW	3	63781390	nonsense	probably null
R6317:Plch1	UTSW	3	63781390	nonsense	probably null
R6318:Plch1	UTSW	3	63781390	nonsense	probably null
R6324:Plch1	UTSW	3	63781390	nonsense	probably null
R6325:Plch1	UTSW	3	63781390	nonsense	probably null
R6326:Plch1	UTSW	3	63781390	nonsense	probably null
R6544:Plch1	UTSW	3	63850978	missense	probably damaging	1.00
R6767:Plch1	UTSW	3	63755344	missense	probably damaging	1.00
R6829:Plch1	UTSW	3	63697518	missense	probably damaging	0.99
R6891:Plch1	UTSW	3	63698083	missense	probably benign
R6893:Plch1	UTSW	3	63753141	nonsense	probably null
R6921:Plch1	UTSW	3	63707734	missense	possibly damaging	0.90
R7298:Plch1	UTSW	3	63716037	nonsense	probably null
R7396:Plch1	UTSW	3	63698954	missense	probably benign	0.00
R7420:Plch1	UTSW	3	63722857	missense	probably damaging	1.00
R7566:Plch1	UTSW	3	63781242	intron	probably null
R7572:Plch1	UTSW	3	63740684	missense	possibly damaging	0.89
R7649:Plch1	UTSW	3	63698169	nonsense	probably null
R7696:Plch1	UTSW	3	63755305	missense	probably benign
RF018:Plch1	UTSW	3	63721215	missense	probably damaging	1.00
X0028:Plch1	UTSW	3	63744509	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- ATCTAATCGTTGCTGGGAGCTG -3'
(R):5'- CTCCTAAAGTATGCCAGAATGTTC -3'

Sequencing Primer
(F):5'- CTGGAAGAGAGCTGCGGC -3'
(R):5'- CTAAAGTATGCCAGAATGTTCAATTC -3'

Posted On

2018-05-21