Incidental Mutation 'R6479:Slit2'
ID 516970
Institutional Source Beutler Lab
Gene Symbol Slit2
Ensembl Gene ENSMUSG00000031558
Gene Name slit guidance ligand 2
Synonyms Drad-1, Slil3, E130320P19Rik, E030015M03Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_178804.3; MGI: 1315205

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6479 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 47983138-48307733 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 48231989 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 585 (L585H)
Ref Sequence ENSEMBL: ENSMUSP00000133912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033967] [ENSMUST00000170109] [ENSMUST00000173107] [ENSMUST00000174313] [ENSMUST00000174421]
AlphaFold Q9R1B9
Predicted Effect probably damaging
Transcript: ENSMUST00000033967
AA Change: L581H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033967
Gene: ENSMUSG00000031558
AA Change: L581H

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LRRNT 27 59 6.53e-9 SMART
LRR 53 77 1.41e2 SMART
LRR_TYP 78 101 1.79e-2 SMART
LRR 102 125 2.45e0 SMART
LRR 126 149 9.96e-1 SMART
LRR 154 173 1.29e2 SMART
LRR_TYP 174 197 2.05e-2 SMART
LRRCT 209 258 3.42e-9 SMART
LRRNT 272 304 4.55e-8 SMART
LRR 298 322 3e1 SMART
LRR_TYP 323 346 1.95e-3 SMART
LRR_TYP 347 370 2.24e-3 SMART
LRR 371 394 1.31e0 SMART
LRR 395 418 2.49e-1 SMART
LRRCT 430 479 1.88e-6 SMART
LRRNT 497 529 1.45e-6 SMART
LRR_TYP 549 572 1.38e-3 SMART
LRR 597 620 9.96e-1 SMART
LRR_TYP 621 644 2.71e-2 SMART
LRRCT 656 705 3.56e-7 SMART
LRRNT 718 750 3.69e-8 SMART
LRR 768 791 7.36e0 SMART
LRR_TYP 792 815 5.59e-4 SMART
LRR_TYP 816 839 7.9e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170109
AA Change: L593H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127615
Gene: ENSMUSG00000031558
AA Change: L593H

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LRRNT 27 59 6.53e-9 SMART
LRR 53 77 1.41e2 SMART
LRR_TYP 78 101 1.79e-2 SMART
LRR 102 125 2.45e0 SMART
LRR 126 149 9.96e-1 SMART
LRR 154 173 1.29e2 SMART
LRR_TYP 174 197 2.05e-2 SMART
LRRCT 209 258 3.42e-9 SMART
LRRNT 272 304 4.55e-8 SMART
LRR 298 322 3e1 SMART
LRR_TYP 323 346 1.95e-3 SMART
LRR_TYP 347 370 2.24e-3 SMART
LRR 371 394 1.31e0 SMART
LRR 395 418 2.49e-1 SMART
LRRCT 430 479 1.88e-6 SMART
LRRNT 497 529 1.45e-6 SMART
LRR_TYP 549 572 1.38e-3 SMART
LRR 597 620 9.96e-1 SMART
LRR_TYP 621 644 2.71e-2 SMART
LRRCT 656 705 3.56e-7 SMART
LRRNT 718 750 3.69e-8 SMART
LRR 768 791 7.36e0 SMART
LRR_TYP 792 815 5.59e-4 SMART
LRR_TYP 816 839 7.9e-4 SMART
LRRCT 851 900 3.9e-13 SMART
EGF 913 947 3.73e-5 SMART
EGF 952 988 4.35e-6 SMART
EGF_CA 990 1026 2.21e-7 SMART
FOLN 993 1015 5.84e1 SMART
EGF 1031 1066 1.07e-5 SMART
EGF_CA 1068 1104 3.97e-9 SMART
FOLN 1116 1138 2.22e0 SMART
EGF 1116 1149 1.62e-5 SMART
LamG 1172 1308 4.82e-39 SMART
EGF 1327 1360 3.68e-4 SMART
EGF 1366 1399 3.88e-3 SMART
FOLN 1407 1429 3.34e0 SMART
EGF 1407 1440 4.46e-3 SMART
CT 1451 1520 4.23e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172824
Predicted Effect probably damaging
Transcript: ENSMUST00000173107
AA Change: L581H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133840
Gene: ENSMUSG00000031558
AA Change: L581H

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LRRNT 27 59 6.53e-9 SMART
LRR 53 77 1.41e2 SMART
LRR_TYP 78 101 1.79e-2 SMART
LRR 102 125 2.45e0 SMART
LRR 126 149 9.96e-1 SMART
LRR 154 173 1.29e2 SMART
LRR_TYP 174 197 2.05e-2 SMART
LRRCT 209 258 3.42e-9 SMART
LRRNT 272 304 4.55e-8 SMART
LRR 298 322 3e1 SMART
LRR_TYP 323 346 1.95e-3 SMART
LRR_TYP 347 370 2.24e-3 SMART
LRR 371 394 1.31e0 SMART
LRR 395 418 2.49e-1 SMART
LRRCT 430 479 1.88e-6 SMART
LRRNT 505 537 1.45e-6 SMART
LRR_TYP 557 580 1.38e-3 SMART
LRR 605 628 9.96e-1 SMART
LRR_TYP 629 652 2.71e-2 SMART
LRRCT 664 713 3.56e-7 SMART
LRRNT 726 758 3.69e-8 SMART
LRR 776 799 7.36e0 SMART
LRR_TYP 800 823 5.59e-4 SMART
LRR_TYP 824 847 7.9e-4 SMART
LRRCT 859 908 3.9e-13 SMART
EGF 921 955 3.73e-5 SMART
EGF 960 996 4.35e-6 SMART
EGF_CA 998 1034 2.21e-7 SMART
FOLN 1001 1023 5.84e1 SMART
EGF 1039 1074 1.07e-5 SMART
EGF_CA 1076 1112 3.97e-9 SMART
FOLN 1124 1146 2.22e0 SMART
EGF 1124 1157 1.62e-5 SMART
LamG 1180 1316 4.82e-39 SMART
EGF 1335 1368 3.68e-4 SMART
EGF 1374 1407 3.88e-3 SMART
FOLN 1415 1437 3.34e0 SMART
EGF 1415 1448 4.46e-3 SMART
CT 1459 1528 4.23e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174313
AA Change: L585H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133912
Gene: ENSMUSG00000031558
AA Change: L585H

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LRRNT 27 59 6.53e-9 SMART
LRR 53 77 1.41e2 SMART
LRR_TYP 78 101 1.79e-2 SMART
LRR 102 125 2.45e0 SMART
LRR 126 149 9.96e-1 SMART
LRR 154 173 1.29e2 SMART
LRR_TYP 174 197 2.05e-2 SMART
LRRCT 209 258 3.42e-9 SMART
LRRNT 276 308 4.55e-8 SMART
LRR 302 326 3e1 SMART
LRR_TYP 327 350 1.95e-3 SMART
LRR_TYP 351 374 2.24e-3 SMART
LRR 375 398 1.31e0 SMART
LRR 399 422 2.49e-1 SMART
LRRCT 434 483 1.88e-6 SMART
LRRNT 501 533 1.45e-6 SMART
LRR_TYP 553 576 1.38e-3 SMART
LRR 601 624 9.96e-1 SMART
LRR_TYP 625 648 2.71e-2 SMART
LRRCT 660 709 3.56e-7 SMART
LRRNT 722 754 3.69e-8 SMART
LRR 772 795 7.36e0 SMART
LRR_TYP 796 819 5.59e-4 SMART
LRR_TYP 820 843 7.9e-4 SMART
LRRCT 855 904 3.9e-13 SMART
EGF 917 951 3.73e-5 SMART
EGF 956 992 4.35e-6 SMART
EGF_CA 994 1030 2.21e-7 SMART
FOLN 997 1019 5.84e1 SMART
EGF 1035 1070 1.07e-5 SMART
EGF_CA 1072 1108 3.97e-9 SMART
FOLN 1120 1142 2.22e0 SMART
EGF 1120 1153 1.62e-5 SMART
LamG 1176 1312 4.82e-39 SMART
EGF 1331 1364 3.68e-4 SMART
EGF 1370 1403 3.88e-3 SMART
FOLN 1411 1433 3.34e0 SMART
EGF 1411 1444 4.46e-3 SMART
CT 1455 1524 4.23e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174421
AA Change: L593H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134263
Gene: ENSMUSG00000031558
AA Change: L593H

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LRRNT 27 59 6.53e-9 SMART
LRR 53 77 1.41e2 SMART
LRR_TYP 78 101 1.79e-2 SMART
LRR 102 125 2.45e0 SMART
LRR 126 149 9.96e-1 SMART
LRR 154 173 1.29e2 SMART
LRR_TYP 174 197 2.05e-2 SMART
LRRCT 209 258 3.42e-9 SMART
LRRNT 276 308 4.55e-8 SMART
LRR 302 326 3e1 SMART
LRR_TYP 327 350 1.95e-3 SMART
LRR_TYP 351 374 2.24e-3 SMART
LRR 375 398 1.31e0 SMART
LRR 399 422 2.49e-1 SMART
LRRCT 434 483 1.88e-6 SMART
LRRNT 509 541 1.45e-6 SMART
LRR_TYP 561 584 1.38e-3 SMART
LRR 609 632 9.96e-1 SMART
LRR_TYP 633 656 2.71e-2 SMART
LRRCT 668 717 3.56e-7 SMART
LRRNT 730 762 3.69e-8 SMART
LRR 780 803 7.36e0 SMART
LRR_TYP 804 827 5.59e-4 SMART
LRR_TYP 828 851 7.9e-4 SMART
LRRCT 863 912 3.9e-13 SMART
EGF 925 959 3.73e-5 SMART
EGF 964 1000 4.35e-6 SMART
EGF_CA 1002 1047 4.74e-7 SMART
FOLN 1005 1027 5.84e1 SMART
EGF 1052 1087 1.07e-5 SMART
EGF_CA 1089 1125 3.97e-9 SMART
FOLN 1137 1159 2.22e0 SMART
EGF 1137 1170 1.62e-5 SMART
LamG 1193 1329 4.82e-39 SMART
EGF 1348 1381 3.68e-4 SMART
EGF 1387 1420 3.88e-3 SMART
FOLN 1428 1450 3.34e0 SMART
EGF 1428 1461 4.46e-3 SMART
CT 1472 1541 4.23e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174487
Meta Mutation Damage Score 0.9538 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.0%
Validation Efficiency 95% (55/58)
MGI Phenotype Strain: 2179460
FUNCTION: The protein encoded by this gene is a member of the Slit family of secreted glycoproteins, which function as ligands for the Robo family of immunoglobulin receptors. Slit proteins play highly conserved roles in axon guidance and neuronal migration and may also have functions during other cell migration processes including leukocyte migration. In mammals, members of the slit family are characterized by an N-terminal signal peptide, four leucine-rich repeats, nine epidermal growth factor repeats, and a C-terminal cysteine knot. Mice deficient for this gene exhibit abnormal axonal projections in the embryonic forebrain and develop supernumerary uretic buds that maintain improper connections to the nephric duct. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutants display perinatal lethality, abnormal ureteric bud development, multiple fused kidneys, multiple ureters, and hydroureter. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 A C 8: 24,629,665 S533A probably benign Het
Akap6 T G 12: 53,141,169 S1789A probably damaging Het
Alox15 A G 11: 70,345,185 S519P probably damaging Het
Anapc2 A G 2: 25,285,395 K816E probably benign Het
Atp6v1a T C 16: 44,098,758 D488G probably benign Het
Banp A G 8: 121,991,437 probably null Het
Camsap1 A G 2: 25,935,862 C1367R possibly damaging Het
Casz1 C A 4: 148,937,078 H539Q probably damaging Het
Ccl5 A G 11: 83,530,386 Y26H probably benign Het
Cops3 A T 11: 59,833,072 S86R probably benign Het
Cts7 A G 13: 61,355,641 S170P probably benign Het
Cxcl15 A T 5: 90,795,245 E35D possibly damaging Het
Dennd1b C T 1: 139,041,960 probably benign Het
Dicer1 T C 12: 104,696,723 D1533G probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock4 A G 12: 40,828,955 E1531G probably damaging Het
Erap1 A G 13: 74,663,493 probably null Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gm10309 A T 17: 86,504,579 M1K probably null Het
Gm21994 C T 2: 150,254,591 G306D probably damaging Het
Gm4450 T A 3: 98,446,841 E114V possibly damaging Het
Gm4884 A T 7: 41,040,787 N36Y probably damaging Het
Hmcn1 G A 1: 150,677,302 R2546* probably null Het
Hmcn2 A G 2: 31,425,468 D3743G probably damaging Het
Irak2 A T 6: 113,686,941 N423Y probably damaging Het
Jarid2 G A 13: 44,848,289 G26D probably benign Het
Kif13b A G 14: 64,751,525 K785R probably benign Het
Lamc3 A T 2: 31,887,401 I20F probably benign Het
Limk1 G A 5: 134,661,519 probably benign Het
Lrp4 C T 2: 91,487,084 T851I probably damaging Het
Med13 G A 11: 86,357,527 probably benign Het
Megf10 T C 18: 57,246,570 F273L possibly damaging Het
Meltf T A 16: 31,881,882 D73E probably damaging Het
Mroh7 A G 4: 106,703,188 F640L possibly damaging Het
Mtor T C 4: 148,551,000 S2448P probably benign Het
Myo3a T C 2: 22,577,865 V377A probably benign Het
Myo5b T C 18: 74,617,015 V183A probably damaging Het
Nedd4l G A 18: 65,209,681 R755H probably damaging Het
Nrde2 T C 12: 100,143,948 T275A probably benign Het
Olfr658 A G 7: 104,645,126 I80T probably benign Het
Osgepl1 T C 1: 53,321,543 V381A probably benign Het
Pcdha1 C T 18: 36,931,456 T391I probably benign Het
Pdp1 T C 4: 11,961,327 N328S probably damaging Het
Pepd A G 7: 35,040,722 E340G probably benign Het
Plch1 T C 3: 63,744,510 T387A probably benign Het
Plxnb1 C A 9: 109,111,665 T1536K possibly damaging Het
Rbp7 T C 4: 149,449,890 T130A probably benign Het
Rhot2 A T 17: 25,841,080 V309E probably benign Het
Slc37a1 A G 17: 31,338,990 I421M possibly damaging Het
Spint4 C A 2: 164,700,844 A119D probably benign Het
Strip2 G T 6: 29,944,497 probably null Het
Stxbp4 T C 11: 90,619,187 Y59C probably damaging Het
Syne1 G A 10: 5,231,679 Q4219* probably null Het
Syne1 A T 10: 5,456,826 I37N probably damaging Het
Syne4 G T 7: 30,316,915 G179* probably null Het
Tead1 T C 7: 112,861,465 V192A probably benign Het
Trim37 G T 11: 87,216,487 E317* probably null Het
Wdfy3 A C 5: 101,913,179 Y1390D probably damaging Het
Wdr81 A G 11: 75,452,105 F779L possibly damaging Het
Other mutations in Slit2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Slit2 APN 5 48304032 missense possibly damaging 0.86
IGL00809:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00811:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00813:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00815:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00816:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00817:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00819:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00820:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00822:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL01077:Slit2 APN 5 48217443 splice site probably null
IGL01375:Slit2 APN 5 48281714 splice site probably benign
IGL01481:Slit2 APN 5 48302931 missense probably benign 0.05
IGL01934:Slit2 APN 5 48238405 missense possibly damaging 0.93
IGL01992:Slit2 APN 5 48238417 missense probably benign 0.01
IGL02315:Slit2 APN 5 47987871 missense probably damaging 0.98
IGL02328:Slit2 APN 5 48230304 missense probably damaging 1.00
IGL02366:Slit2 APN 5 48304068 missense possibly damaging 0.53
IGL02526:Slit2 APN 5 48304223 nonsense probably null
IGL02852:Slit2 APN 5 48244672 missense probably damaging 1.00
IGL02887:Slit2 APN 5 48217474 missense probably benign 0.44
IGL03123:Slit2 APN 5 48211339 missense probably damaging 1.00
IGL03182:Slit2 APN 5 48220053 missense possibly damaging 0.77
P0025:Slit2 UTSW 5 48304035 missense probably damaging 0.96
R0032:Slit2 UTSW 5 48256856 missense probably damaging 0.99
R0032:Slit2 UTSW 5 48256856 missense probably damaging 0.99
R0055:Slit2 UTSW 5 48281726 nonsense probably null
R0055:Slit2 UTSW 5 48281726 nonsense probably null
R0267:Slit2 UTSW 5 48182331 splice site probably benign
R0552:Slit2 UTSW 5 48238379 missense probably damaging 1.00
R0610:Slit2 UTSW 5 48275674 missense possibly damaging 0.77
R0883:Slit2 UTSW 5 48245573 splice site probably benign
R1390:Slit2 UTSW 5 48217490 missense probably benign 0.06
R1442:Slit2 UTSW 5 48238383 missense probably damaging 0.96
R1453:Slit2 UTSW 5 48257051 missense possibly damaging 0.88
R1508:Slit2 UTSW 5 48192249 missense probably damaging 0.98
R1639:Slit2 UTSW 5 48259654 missense probably damaging 1.00
R1705:Slit2 UTSW 5 48189472 missense probably damaging 0.99
R1828:Slit2 UTSW 5 48304030 missense probably damaging 1.00
R1897:Slit2 UTSW 5 48238423 missense probably damaging 1.00
R1908:Slit2 UTSW 5 48281988 missense probably damaging 1.00
R1919:Slit2 UTSW 5 48191016 unclassified probably benign
R1982:Slit2 UTSW 5 48249836 missense probably damaging 1.00
R2013:Slit2 UTSW 5 48302490 missense probably damaging 1.00
R2136:Slit2 UTSW 5 48304225 missense probably benign 0.03
R2655:Slit2 UTSW 5 48189575 missense possibly damaging 0.88
R3402:Slit2 UTSW 5 48283421 missense probably damaging 0.98
R3724:Slit2 UTSW 5 48256883 critical splice donor site probably null
R4176:Slit2 UTSW 5 48237244 splice site probably null
R4306:Slit2 UTSW 5 48302783 missense possibly damaging 0.83
R4397:Slit2 UTSW 5 48220081 critical splice donor site probably null
R4525:Slit2 UTSW 5 48249873 missense probably damaging 1.00
R4688:Slit2 UTSW 5 48257003 splice site probably null
R5026:Slit2 UTSW 5 48256805 missense probably damaging 0.99
R5138:Slit2 UTSW 5 48281967 missense probably damaging 1.00
R5465:Slit2 UTSW 5 48249912 missense probably damaging 1.00
R5471:Slit2 UTSW 5 48189555 missense probably damaging 1.00
R5699:Slit2 UTSW 5 48220991 critical splice donor site probably null
R5735:Slit2 UTSW 5 48259616 missense probably damaging 1.00
R5834:Slit2 UTSW 5 48259647 missense probably damaging 1.00
R5967:Slit2 UTSW 5 47985164 missense probably damaging 0.99
R6150:Slit2 UTSW 5 48304174 missense probably damaging 1.00
R6219:Slit2 UTSW 5 48302428 missense possibly damaging 0.53
R6344:Slit2 UTSW 5 48219681 missense probably benign 0.07
R6408:Slit2 UTSW 5 47984986 unclassified probably benign
R6526:Slit2 UTSW 5 48304167 missense probably damaging 0.99
R6959:Slit2 UTSW 5 48238385 missense possibly damaging 0.83
R7139:Slit2 UTSW 5 48244683 missense probably benign 0.19
R7201:Slit2 UTSW 5 48237285 missense probably null 0.85
R7472:Slit2 UTSW 5 48256838 missense probably damaging 0.97
R7491:Slit2 UTSW 5 48219994 missense probably benign 0.18
R7566:Slit2 UTSW 5 48249897 missense probably damaging 0.99
R7622:Slit2 UTSW 5 47985205 missense probably damaging 0.98
R7831:Slit2 UTSW 5 48244683 missense probably benign 0.19
R7870:Slit2 UTSW 5 48302307 missense probably damaging 0.99
R7899:Slit2 UTSW 5 48247185 missense possibly damaging 0.89
R7969:Slit2 UTSW 5 48304036 missense possibly damaging 0.47
R7984:Slit2 UTSW 5 48176123 intron probably benign
R8021:Slit2 UTSW 5 48302492 nonsense probably null
R8253:Slit2 UTSW 5 48275671 missense probably benign 0.00
R8321:Slit2 UTSW 5 48230267 missense probably damaging 1.00
R8426:Slit2 UTSW 5 48224763 missense probably benign 0.00
R8513:Slit2 UTSW 5 48224708 nonsense probably null
R8756:Slit2 UTSW 5 48302487 nonsense probably null
R8796:Slit2 UTSW 5 48302848 missense probably benign 0.01
R8799:Slit2 UTSW 5 48304182 missense possibly damaging 0.73
R8947:Slit2 UTSW 5 48249798 missense probably damaging 1.00
R9005:Slit2 UTSW 5 48302518 missense possibly damaging 0.73
R9173:Slit2 UTSW 5 48219943 missense probably damaging 0.98
R9310:Slit2 UTSW 5 48192226 missense possibly damaging 0.59
R9365:Slit2 UTSW 5 48304192 missense probably benign 0.04
Z1088:Slit2 UTSW 5 48302353 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCGCAATACTGGCAGTG -3'
(R):5'- ATGTCTGAGATATTGAGCCACTG -3'

Sequencing Primer
(F):5'- CTTCGCAATACTGGCAGTGAAAGTC -3'
(R):5'- TCTGAGATATTGAGCCACTGAGCTAG -3'
Posted On 2018-05-21