Incidental Mutation 'R6479:Adam18'
ID516980
Institutional Source Beutler Lab
Gene Symbol Adam18
Ensembl Gene ENSMUSG00000031552
Gene Namea disintegrin and metallopeptidase domain 18
SynonymsAdam27, Dtgn3
Accession Numbers

Genbank: NM_010084

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6479 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location24602246-24674755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 24629665 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 533 (S533A)
Ref Sequence ENSEMBL: ENSMUSP00000133378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033957] [ENSMUST00000138232] [ENSMUST00000173833]
Predicted Effect probably benign
Transcript: ENSMUST00000033957
AA Change: S533A

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000033957
Gene: ENSMUSG00000031552
AA Change: S533A

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 15 140 1.7e-25 PFAM
Pfam:Reprolysin 180 377 1.1e-57 PFAM
DISIN 396 474 1.03e-35 SMART
ACR 475 613 1.12e-51 SMART
transmembrane domain 684 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138232
Predicted Effect probably benign
Transcript: ENSMUST00000173833
AA Change: S533A

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133378
Gene: ENSMUSG00000031552
AA Change: S533A

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 15 140 9.5e-35 PFAM
Pfam:Reprolysin 180 378 7.7e-56 PFAM
DISIN 396 474 1.03e-35 SMART
ACR 475 613 1.12e-51 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.0%
Validation Efficiency 95% (55/58)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is expressed in a regulated fashion during early stages of spermatogenesis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of related ADAM genes on chromosome 8. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous mutant mice exhibit enhanced motor coordination during inverted screen testing when compared with that of controls. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 T G 12: 53,141,169 S1789A probably damaging Het
Alox15 A G 11: 70,345,185 S519P probably damaging Het
Anapc2 A G 2: 25,285,395 K816E probably benign Het
Atp6v1a T C 16: 44,098,758 D488G probably benign Het
Banp A G 8: 121,991,437 probably null Het
Camsap1 A G 2: 25,935,862 C1367R possibly damaging Het
Casz1 C A 4: 148,937,078 H539Q probably damaging Het
Ccl5 A G 11: 83,530,386 Y26H probably benign Het
Cops3 A T 11: 59,833,072 S86R probably benign Het
Cts7 A G 13: 61,355,641 S170P probably benign Het
Cxcl15 A T 5: 90,795,245 E35D possibly damaging Het
Dennd1b C T 1: 139,041,960 probably benign Het
Dicer1 T C 12: 104,696,723 D1533G probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock4 A G 12: 40,828,955 E1531G probably damaging Het
Erap1 A G 13: 74,663,493 probably null Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gm10309 A T 17: 86,504,579 M1K probably null Het
Gm21994 C T 2: 150,254,591 G306D probably damaging Het
Gm4450 T A 3: 98,446,841 E114V possibly damaging Het
Gm4884 A T 7: 41,040,787 N36Y probably damaging Het
Hmcn1 G A 1: 150,677,302 R2546* probably null Het
Hmcn2 A G 2: 31,425,468 D3743G probably damaging Het
Irak2 A T 6: 113,686,941 N423Y probably damaging Het
Jarid2 G A 13: 44,848,289 G26D probably benign Het
Kif13b A G 14: 64,751,525 K785R probably benign Het
Lamc3 A T 2: 31,887,401 I20F probably benign Het
Limk1 G A 5: 134,661,519 probably benign Het
Lrp4 C T 2: 91,487,084 T851I probably damaging Het
Med13 G A 11: 86,357,527 probably benign Het
Megf10 T C 18: 57,246,570 F273L possibly damaging Het
Meltf T A 16: 31,881,882 D73E probably damaging Het
Mroh7 A G 4: 106,703,188 F640L possibly damaging Het
Mtor T C 4: 148,551,000 S2448P probably benign Het
Myo3a T C 2: 22,577,865 V377A probably benign Het
Myo5b T C 18: 74,617,015 V183A probably damaging Het
Nedd4l G A 18: 65,209,681 R755H probably damaging Het
Nrde2 T C 12: 100,143,948 T275A probably benign Het
Olfr658 A G 7: 104,645,126 I80T probably benign Het
Osgepl1 T C 1: 53,321,543 V381A probably benign Het
Pcdha1 C T 18: 36,931,456 T391I probably benign Het
Pdp1 T C 4: 11,961,327 N328S probably damaging Het
Pepd A G 7: 35,040,722 E340G probably benign Het
Plch1 T C 3: 63,744,510 T387A probably benign Het
Plxnb1 C A 9: 109,111,665 T1536K possibly damaging Het
Rbp7 T C 4: 149,449,890 T130A probably benign Het
Rhot2 A T 17: 25,841,080 V309E probably benign Het
Slc37a1 A G 17: 31,338,990 I421M possibly damaging Het
Slit2 T A 5: 48,231,989 L585H probably damaging Het
Spint4 C A 2: 164,700,844 A119D probably benign Het
Strip2 G T 6: 29,944,497 probably null Het
Stxbp4 T C 11: 90,619,187 Y59C probably damaging Het
Syne1 G A 10: 5,231,679 Q4219* probably null Het
Syne1 A T 10: 5,456,826 I37N probably damaging Het
Syne4 G T 7: 30,316,915 G179* probably null Het
Tead1 T C 7: 112,861,465 V192A probably benign Het
Trim37 G T 11: 87,216,487 E317* probably null Het
Wdfy3 A C 5: 101,913,179 Y1390D probably damaging Het
Wdr81 A G 11: 75,452,105 F779L possibly damaging Het
Other mutations in Adam18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Adam18 APN 8 24628133 missense probably damaging 1.00
IGL01649:Adam18 APN 8 24614896 missense possibly damaging 0.82
IGL02212:Adam18 APN 8 24637179 missense probably benign 0.02
IGL02455:Adam18 APN 8 24651848 missense probably damaging 0.96
IGL02525:Adam18 APN 8 24611044 missense probably benign 0.00
IGL02525:Adam18 APN 8 24641767 splice site probably benign
IGL02966:Adam18 APN 8 24611149 splice site probably benign
IGL03136:Adam18 APN 8 24641836 missense probably damaging 1.00
G5030:Adam18 UTSW 8 24651856 missense probably benign 0.24
R0135:Adam18 UTSW 8 24665542 missense possibly damaging 0.71
R0280:Adam18 UTSW 8 24674054 missense probably benign 0.06
R0389:Adam18 UTSW 8 24629637 splice site probably null
R0390:Adam18 UTSW 8 24674054 missense probably benign 0.06
R0443:Adam18 UTSW 8 24629637 splice site probably null
R0479:Adam18 UTSW 8 24651822 missense probably benign
R0578:Adam18 UTSW 8 24641847 missense possibly damaging 0.82
R0645:Adam18 UTSW 8 24672120 nonsense probably null
R0881:Adam18 UTSW 8 24672143 splice site probably benign
R0885:Adam18 UTSW 8 24651786 missense probably damaging 1.00
R0973:Adam18 UTSW 8 24647853 missense probably benign 0.01
R0973:Adam18 UTSW 8 24647853 missense probably benign 0.01
R0974:Adam18 UTSW 8 24647853 missense probably benign 0.01
R1005:Adam18 UTSW 8 24665514 missense probably benign 0.05
R1356:Adam18 UTSW 8 24668595 splice site probably benign
R1510:Adam18 UTSW 8 24625831 missense probably benign 0.01
R1552:Adam18 UTSW 8 24646361 missense probably benign
R1568:Adam18 UTSW 8 24647783 splice site probably null
R1639:Adam18 UTSW 8 24652152 missense probably benign 0.00
R1968:Adam18 UTSW 8 24646447 missense probably benign 0.32
R2029:Adam18 UTSW 8 24650877 missense probably damaging 1.00
R2058:Adam18 UTSW 8 24672066 splice site probably benign
R2211:Adam18 UTSW 8 24628155 missense probably damaging 0.96
R2237:Adam18 UTSW 8 24646287 missense probably benign 0.01
R2238:Adam18 UTSW 8 24646287 missense probably benign 0.01
R2239:Adam18 UTSW 8 24646287 missense probably benign 0.01
R2518:Adam18 UTSW 8 24637141 missense probably damaging 1.00
R3122:Adam18 UTSW 8 24628232 missense possibly damaging 0.74
R3426:Adam18 UTSW 8 24667604 missense probably damaging 1.00
R3428:Adam18 UTSW 8 24667604 missense probably damaging 1.00
R3967:Adam18 UTSW 8 24629710 missense probably benign 0.12
R4833:Adam18 UTSW 8 24674101 missense probably benign 0.01
R4965:Adam18 UTSW 8 24641811 missense probably damaging 1.00
R5249:Adam18 UTSW 8 24625852 missense probably benign 0.00
R5534:Adam18 UTSW 8 24665514 missense probably benign 0.05
R5920:Adam18 UTSW 8 24674075 missense probably damaging 1.00
R6329:Adam18 UTSW 8 24614827 missense probably damaging 1.00
R6450:Adam18 UTSW 8 24629675 missense probably benign 0.05
R6516:Adam18 UTSW 8 24674687 missense probably damaging 1.00
R6603:Adam18 UTSW 8 24665502 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TTTCTACCACACAACTGGCTAG -3'
(R):5'- AAGCACGCCCATTTTGAAATG -3'

Sequencing Primer
(F):5'- ATTTCTGAGTTCGAGGCCAGCC -3'
(R):5'- GCTTTAGGTTCTCAAGGG -3'
Posted On2018-05-21