Incidental Mutation 'R6479:Nrde2'
ID516994
Institutional Source Beutler Lab
Gene Symbol Nrde2
Ensembl Gene ENSMUSG00000021179
Gene Namenrde-2 necessary for RNA interference, domain containing
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6479 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location100125452-100159653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100143948 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 275 (T275A)
Ref Sequence ENSEMBL: ENSMUSP00000021596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021596] [ENSMUST00000221954]
Predicted Effect probably benign
Transcript: ENSMUST00000021596
AA Change: T275A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000021596
Gene: ENSMUSG00000021179
AA Change: T275A

DomainStartEndE-ValueType
low complexity region 85 107 N/A INTRINSIC
low complexity region 146 154 N/A INTRINSIC
Pfam:NRDE-2 318 658 1.2e-107 PFAM
Blast:HAT 765 800 2e-10 BLAST
Blast:HAT 802 841 3e-16 BLAST
Blast:HAT 986 1018 3e-10 BLAST
Blast:HAT 1075 1109 1e-14 BLAST
Blast:HAT 1111 1143 8e-15 BLAST
low complexity region 1154 1171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221954
Meta Mutation Damage Score 0.1515 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.0%
Validation Efficiency 95% (55/58)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 A C 8: 24,629,665 S533A probably benign Het
Akap6 T G 12: 53,141,169 S1789A probably damaging Het
Alox15 A G 11: 70,345,185 S519P probably damaging Het
Anapc2 A G 2: 25,285,395 K816E probably benign Het
Atp6v1a T C 16: 44,098,758 D488G probably benign Het
Banp A G 8: 121,991,437 probably null Het
Camsap1 A G 2: 25,935,862 C1367R possibly damaging Het
Casz1 C A 4: 148,937,078 H539Q probably damaging Het
Ccl5 A G 11: 83,530,386 Y26H probably benign Het
Cops3 A T 11: 59,833,072 S86R probably benign Het
Cts7 A G 13: 61,355,641 S170P probably benign Het
Cxcl15 A T 5: 90,795,245 E35D possibly damaging Het
Dennd1b C T 1: 139,041,960 probably benign Het
Dicer1 T C 12: 104,696,723 D1533G probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock4 A G 12: 40,828,955 E1531G probably damaging Het
Erap1 A G 13: 74,663,493 probably null Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gm10309 A T 17: 86,504,579 M1K probably null Het
Gm21994 C T 2: 150,254,591 G306D probably damaging Het
Gm4450 T A 3: 98,446,841 E114V possibly damaging Het
Gm4884 A T 7: 41,040,787 N36Y probably damaging Het
Hmcn1 G A 1: 150,677,302 R2546* probably null Het
Hmcn2 A G 2: 31,425,468 D3743G probably damaging Het
Irak2 A T 6: 113,686,941 N423Y probably damaging Het
Jarid2 G A 13: 44,848,289 G26D probably benign Het
Kif13b A G 14: 64,751,525 K785R probably benign Het
Lamc3 A T 2: 31,887,401 I20F probably benign Het
Limk1 G A 5: 134,661,519 probably benign Het
Lrp4 C T 2: 91,487,084 T851I probably damaging Het
Med13 G A 11: 86,357,527 probably benign Het
Megf10 T C 18: 57,246,570 F273L possibly damaging Het
Meltf T A 16: 31,881,882 D73E probably damaging Het
Mroh7 A G 4: 106,703,188 F640L possibly damaging Het
Mtor T C 4: 148,551,000 S2448P probably benign Het
Myo3a T C 2: 22,577,865 V377A probably benign Het
Myo5b T C 18: 74,617,015 V183A probably damaging Het
Nedd4l G A 18: 65,209,681 R755H probably damaging Het
Olfr658 A G 7: 104,645,126 I80T probably benign Het
Osgepl1 T C 1: 53,321,543 V381A probably benign Het
Pcdha1 C T 18: 36,931,456 T391I probably benign Het
Pdp1 T C 4: 11,961,327 N328S probably damaging Het
Pepd A G 7: 35,040,722 E340G probably benign Het
Plch1 T C 3: 63,744,510 T387A probably benign Het
Plxnb1 C A 9: 109,111,665 T1536K possibly damaging Het
Rbp7 T C 4: 149,449,890 T130A probably benign Het
Rhot2 A T 17: 25,841,080 V309E probably benign Het
Slc37a1 A G 17: 31,338,990 I421M possibly damaging Het
Slit2 T A 5: 48,231,989 L585H probably damaging Het
Spint4 C A 2: 164,700,844 A119D probably benign Het
Strip2 G T 6: 29,944,497 probably null Het
Stxbp4 T C 11: 90,619,187 Y59C probably damaging Het
Syne1 G A 10: 5,231,679 Q4219* probably null Het
Syne1 A T 10: 5,456,826 I37N probably damaging Het
Syne4 G T 7: 30,316,915 G179* probably null Het
Tead1 T C 7: 112,861,465 V192A probably benign Het
Trim37 G T 11: 87,216,487 E317* probably null Het
Wdfy3 A C 5: 101,913,179 Y1390D probably damaging Het
Wdr81 A G 11: 75,452,105 F779L possibly damaging Het
Other mutations in Nrde2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02207:Nrde2 APN 12 100130931 missense probably benign 0.01
IGL02697:Nrde2 APN 12 100131207 missense probably damaging 1.00
IGL02798:Nrde2 APN 12 100143822 nonsense probably null
IGL02810:Nrde2 APN 12 100143758 missense possibly damaging 0.81
IGL02814:Nrde2 APN 12 100144135 missense probably null 0.80
IGL02990:Nrde2 APN 12 100142096 missense probably damaging 1.00
kurtz UTSW 12 100134405 missense possibly damaging 0.92
R0090:Nrde2 UTSW 12 100129286 splice site probably benign
R0576:Nrde2 UTSW 12 100132233 missense possibly damaging 0.82
R0646:Nrde2 UTSW 12 100143846 nonsense probably null
R1130:Nrde2 UTSW 12 100125670 missense probably damaging 0.97
R1216:Nrde2 UTSW 12 100149810 splice site probably benign
R1661:Nrde2 UTSW 12 100149860 missense probably benign 0.19
R2069:Nrde2 UTSW 12 100142232 missense probably damaging 1.00
R4405:Nrde2 UTSW 12 100130584 missense probably benign 0.01
R4422:Nrde2 UTSW 12 100146027 nonsense probably null
R5169:Nrde2 UTSW 12 100129293 critical splice donor site probably null
R5200:Nrde2 UTSW 12 100130497 missense possibly damaging 0.77
R5338:Nrde2 UTSW 12 100130778 missense probably damaging 1.00
R5512:Nrde2 UTSW 12 100142250 missense probably benign 0.20
R5820:Nrde2 UTSW 12 100132287 missense probably benign 0.00
R6019:Nrde2 UTSW 12 100132242 missense probably benign 0.04
R6346:Nrde2 UTSW 12 100132306 missense probably benign 0.01
R6378:Nrde2 UTSW 12 100130757 missense probably damaging 0.99
R6523:Nrde2 UTSW 12 100134405 missense possibly damaging 0.92
R7073:Nrde2 UTSW 12 100132488 missense probably benign 0.00
R7220:Nrde2 UTSW 12 100130919 missense probably benign 0.05
R7412:Nrde2 UTSW 12 100142250 nonsense probably null
R7505:Nrde2 UTSW 12 100132498 missense probably benign 0.15
R7699:Nrde2 UTSW 12 100130835 missense probably benign 0.16
R7700:Nrde2 UTSW 12 100130835 missense probably benign 0.16
R7733:Nrde2 UTSW 12 100144140 missense possibly damaging 0.92
R7868:Nrde2 UTSW 12 100131187 missense possibly damaging 0.65
R7951:Nrde2 UTSW 12 100131187 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- CCAGGACAGTGACACTTACC -3'
(R):5'- TTCTGCAGCAAAGAAGCACTC -3'

Sequencing Primer
(F):5'- ATCCATAGTTGCGTGTCCCAAGG -3'
(R):5'- GCAAAGAAGCACTCACACAGG -3'
Posted On2018-05-21