Mutagenetix > Incidental Mutations

Incidental Mutation 'R6479:Dicer1'

516995

Institutional Source

Beutler Lab

Gene Symbol

Dicer1

Ensembl Gene

ENSMUSG00000041415

Gene Name

dicer 1, ribonuclease type III

Synonyms

D12Ertd7e

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_148948.2; MGI:2177178

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6479 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104687742-104751952 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 104696723 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1533 (D1533G)

Ref Sequence

ENSEMBL: ENSMUSP00000043676 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041987]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000041987
AA Change: D1533G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000043676
Gene: ENSMUSG00000041415
AA Change: D1533G

Domain	Start	End	E-Value	Type
DEXDc	30	233	5.14e-24	SMART
low complexity region	403	419	N/A	INTRINSIC
HELICc	449	546	3.15e-10	SMART
Pfam:Dicer_dimer	620	707	1.4e-25	PFAM
low complexity region	713	723	N/A	INTRINSIC
PAZ	881	1056	1.67e-48	SMART
Blast:PAZ	1080	1129	2e-8	BLAST
RIBOc	1285	1582	1.83e-35	SMART
RIBOc	1665	1831	5.97e-49	SMART
DSRM	1834	1897	6.89e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222115

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222519

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222528

Meta Mutation Damage Score

0.5882

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.7%
20x: 92.0%

Validation Efficiency

95% (55/58)

MGI Phenotype

Strain: 3589209; 3809262; 2681012; 3576927
Lethality: E7-E14
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein possessing an RNA helicase motif containing a DEXH box in its amino terminus and an RNA motif in the carboxy terminus. The encoded protein functions as a ribonuclease and is required by the RNA interference and small temporal RNA (stRNA) pathways to produce the active small RNA component that represses gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mutation of this locus results in arrest of early embryonic development. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted(14) Gene trapped(11)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam18	A	C	8: 24,629,665	S533A	probably benign	Het
Akap6	T	G	12: 53,141,169	S1789A	probably damaging	Het
Alox15	A	G	11: 70,345,185	S519P	probably damaging	Het
Anapc2	A	G	2: 25,285,395	K816E	probably benign	Het
Atp6v1a	T	C	16: 44,098,758	D488G	probably benign	Het
Banp	A	G	8: 121,991,437		probably null	Het
Camsap1	A	G	2: 25,935,862	C1367R	possibly damaging	Het
Casz1	C	A	4: 148,937,078	H539Q	probably damaging	Het
Ccl5	A	G	11: 83,530,386	Y26H	probably benign	Het
Cops3	A	T	11: 59,833,072	S86R	probably benign	Het
Cts7	A	G	13: 61,355,641	S170P	probably benign	Het
Cxcl15	A	T	5: 90,795,245	E35D	possibly damaging	Het
Dennd1b	C	T	1: 139,041,960		probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Dock4	A	G	12: 40,828,955	E1531G	probably damaging	Het
Erap1	A	G	13: 74,663,493		probably null	Het
Fsip2	A	G	2: 82,990,086	T5388A	possibly damaging	Het
Gab1	C	A	8: 80,788,597	R364L	possibly damaging	Het
Gm10309	A	T	17: 86,504,579	M1K	probably null	Het
Gm21994	C	T	2: 150,254,591	G306D	probably damaging	Het
Gm4450	T	A	3: 98,446,841	E114V	possibly damaging	Het
Gm4884	A	T	7: 41,040,787	N36Y	probably damaging	Het
Hmcn1	G	A	1: 150,677,302	R2546*	probably null	Het
Hmcn2	A	G	2: 31,425,468	D3743G	probably damaging	Het
Irak2	A	T	6: 113,686,941	N423Y	probably damaging	Het
Jarid2	G	A	13: 44,848,289	G26D	probably benign	Het
Kif13b	A	G	14: 64,751,525	K785R	probably benign	Het
Lamc3	A	T	2: 31,887,401	I20F	probably benign	Het
Limk1	G	A	5: 134,661,519		probably benign	Het
Lrp4	C	T	2: 91,487,084	T851I	probably damaging	Het
Med13	G	A	11: 86,357,527		probably benign	Het
Megf10	T	C	18: 57,246,570	F273L	possibly damaging	Het
Meltf	T	A	16: 31,881,882	D73E	probably damaging	Het
Mroh7	A	G	4: 106,703,188	F640L	possibly damaging	Het
Mtor	T	C	4: 148,551,000	S2448P	probably benign	Het
Myo3a	T	C	2: 22,577,865	V377A	probably benign	Het
Myo5b	T	C	18: 74,617,015	V183A	probably damaging	Het
Nedd4l	G	A	18: 65,209,681	R755H	probably damaging	Het
Nrde2	T	C	12: 100,143,948	T275A	probably benign	Het
Olfr658	A	G	7: 104,645,126	I80T	probably benign	Het
Osgepl1	T	C	1: 53,321,543	V381A	probably benign	Het
Pcdha1	C	T	18: 36,931,456	T391I	probably benign	Het
Pdp1	T	C	4: 11,961,327	N328S	probably damaging	Het
Pepd	A	G	7: 35,040,722	E340G	probably benign	Het
Plch1	T	C	3: 63,744,510	T387A	probably benign	Het
Plxnb1	C	A	9: 109,111,665	T1536K	possibly damaging	Het
Rbp7	T	C	4: 149,449,890	T130A	probably benign	Het
Rhot2	A	T	17: 25,841,080	V309E	probably benign	Het
Slc37a1	A	G	17: 31,338,990	I421M	possibly damaging	Het
Slit2	T	A	5: 48,231,989	L585H	probably damaging	Het
Spint4	C	A	2: 164,700,844	A119D	probably benign	Het
Strip2	G	T	6: 29,944,497		probably null	Het
Stxbp4	T	C	11: 90,619,187	Y59C	probably damaging	Het
Syne1	G	A	10: 5,231,679	Q4219*	probably null	Het
Syne1	A	T	10: 5,456,826	I37N	probably damaging	Het
Syne4	G	T	7: 30,316,915	G179*	probably null	Het
Tead1	T	C	7: 112,861,465	V192A	probably benign	Het
Trim37	G	T	11: 87,216,487	E317*	probably null	Het
Wdfy3	A	C	5: 101,913,179	Y1390D	probably damaging	Het
Wdr81	A	G	11: 75,452,105	F779L	possibly damaging	Het

Other mutations in Dicer1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00943:Dicer1	APN	12	104696772	missense	possibly damaging	0.93
IGL01061:Dicer1	APN	12	104706327	missense	probably null	0.75
IGL01527:Dicer1	APN	12	104691610	nonsense	probably null
IGL01597:Dicer1	APN	12	104705210	nonsense	probably null
IGL01636:Dicer1	APN	12	104722241	missense	probably damaging	1.00
IGL01717:Dicer1	APN	12	104702787	nonsense	probably null
IGL01765:Dicer1	APN	12	104706740	missense	probably damaging	1.00
IGL01871:Dicer1	APN	12	104704180	missense	probably damaging	1.00
IGL02316:Dicer1	APN	12	104702553	missense	probably damaging	1.00
IGL02317:Dicer1	APN	12	104697020	missense	probably damaging	1.00
IGL02539:Dicer1	APN	12	104697035	missense	probably damaging	0.97
IGL02544:Dicer1	APN	12	104714832	missense	probably damaging	1.00
IGL02664:Dicer1	APN	12	104705129	missense	probably damaging	1.00
IGL02667:Dicer1	APN	12	104714906	missense	probably damaging	1.00
IGL03353:Dicer1	APN	12	104713107	missense	probably damaging	1.00
IGL03377:Dicer1	APN	12	104712197	missense	probably damaging	0.98
everest	UTSW	12	104705128	missense	probably damaging	1.00
PIT4480001:Dicer1	UTSW	12	104696544	missense	probably benign
R0032:Dicer1	UTSW	12	104704798	nonsense	probably null
R0032:Dicer1	UTSW	12	104704798	nonsense	probably null
R0219:Dicer1	UTSW	12	104692125	critical splice donor site	probably null
R0242:Dicer1	UTSW	12	104702451	missense	probably benign	0.02
R0242:Dicer1	UTSW	12	104702451	missense	probably benign	0.02
R0385:Dicer1	UTSW	12	104704174	missense	probably damaging	1.00
R0402:Dicer1	UTSW	12	104731064	missense	probably benign	0.04
R0426:Dicer1	UTSW	12	104702542	missense	probably damaging	1.00
R0453:Dicer1	UTSW	12	104702630	missense	probably benign
R0502:Dicer1	UTSW	12	104705060	missense	probably damaging	1.00
R0507:Dicer1	UTSW	12	104691658	missense	probably damaging	1.00
R0511:Dicer1	UTSW	12	104702841	missense	possibly damaging	0.95
R0523:Dicer1	UTSW	12	104702491	missense	probably damaging	1.00
R0559:Dicer1	UTSW	12	104706301	missense	probably damaging	1.00
R0600:Dicer1	UTSW	12	104706864	missense	probably damaging	1.00
R0707:Dicer1	UTSW	12	104706885	missense	probably damaging	1.00
R1225:Dicer1	UTSW	12	104691607	missense	probably damaging	0.98
R1351:Dicer1	UTSW	12	104729142	missense	probably damaging	0.99
R1449:Dicer1	UTSW	12	104729243	missense	possibly damaging	0.85
R1575:Dicer1	UTSW	12	104721969	critical splice donor site	probably null
R1642:Dicer1	UTSW	12	104713156	missense	probably damaging	1.00
R1651:Dicer1	UTSW	12	104708805	missense	probably damaging	1.00
R1658:Dicer1	UTSW	12	104700414	missense	probably benign
R1815:Dicer1	UTSW	12	104722151	missense	probably damaging	1.00
R1816:Dicer1	UTSW	12	104722151	missense	probably damaging	1.00
R1927:Dicer1	UTSW	12	104702884	missense	possibly damaging	0.91
R2113:Dicer1	UTSW	12	104713214	missense	probably damaging	1.00
R2129:Dicer1	UTSW	12	104722031	missense	probably damaging	1.00
R2157:Dicer1	UTSW	12	104702949	missense	probably benign	0.17
R2202:Dicer1	UTSW	12	104731038	missense	probably damaging	0.98
R2203:Dicer1	UTSW	12	104731038	missense	probably damaging	0.98
R2243:Dicer1	UTSW	12	104730188	missense	probably damaging	0.99
R4237:Dicer1	UTSW	12	104729228	missense	possibly damaging	0.48
R4419:Dicer1	UTSW	12	104705114	missense	probably damaging	1.00
R4482:Dicer1	UTSW	12	104706277	missense	probably damaging	1.00
R4564:Dicer1	UTSW	12	104704751	nonsense	probably null
R4776:Dicer1	UTSW	12	104692446	missense	probably damaging	0.99
R4834:Dicer1	UTSW	12	104696591	missense	probably benign	0.44
R4904:Dicer1	UTSW	12	104713066	missense	probably benign
R5202:Dicer1	UTSW	12	104694731	nonsense	probably null
R5272:Dicer1	UTSW	12	104704240	missense	probably damaging	1.00
R5363:Dicer1	UTSW	12	104703151	missense	probably damaging	1.00
R5717:Dicer1	UTSW	12	104705128	missense	probably damaging	1.00
R6381:Dicer1	UTSW	12	104696462	missense	probably benign	0.00
R6956:Dicer1	UTSW	12	104731023	missense	probably damaging	1.00
R7234:Dicer1	UTSW	12	104708849	missense	probably damaging	1.00
R7401:Dicer1	UTSW	12	104712278	missense	probably benign
R7407:Dicer1	UTSW	12	104722351	nonsense	probably null
R7471:Dicer1	UTSW	12	104694710	missense	probably damaging	1.00
R7699:Dicer1	UTSW	12	104705170	missense	probably damaging	1.00
R7768:Dicer1	UTSW	12	104706697	missense	probably damaging	0.99
R7831:Dicer1	UTSW	12	104708800	missense	probably damaging	1.00
R7998:Dicer1	UTSW	12	104704069	missense	probably damaging	1.00
R8010:Dicer1	UTSW	12	104692132	missense	probably damaging	0.99
R8061:Dicer1	UTSW	12	104702818	nonsense	probably null
R8213:Dicer1	UTSW	12	104702693	missense	probably benign	0.00
R8261:Dicer1	UTSW	12	104691606	missense	probably damaging	1.00
R8419:Dicer1	UTSW	12	104702677	missense	probably benign	0.00
R8708:Dicer1	UTSW	12	104728445	missense	possibly damaging	0.65
R8851:Dicer1	UTSW	12	104724041	missense	possibly damaging	0.76
R9220:Dicer1	UTSW	12	104713156	missense	probably damaging	1.00
R9371:Dicer1	UTSW	12	104704732	missense	probably damaging	1.00
R9387:Dicer1	UTSW	12	104729240	missense	possibly damaging	0.48
X0018:Dicer1	UTSW	12	104696934	missense	probably benign	0.00
Z1176:Dicer1	UTSW	12	104731020	missense	probably null	0.97

Predicted Primers

PCR Primer
(F):5'- TCCCTGAAAGGCTCTTTTGTTG -3'
(R):5'- GCATACGAATGGAAGATGCCC -3'

Sequencing Primer
(F):5'- GCTTCCGTTCTCCTGAGCAG -3'
(R):5'- CCCAAGAAGGCCTCCTTG -3'

Posted On

2018-05-21