Mutagenetix > Incidental Mutation

Incidental Mutation 'R6479:Meltf'

517000

Institutional Source

Beutler Lab

Gene Symbol

Meltf

Ensembl Gene

ENSMUSG00000022780

Gene Name

melanotransferrin

Synonyms

MTf, CD228, melanotransferrin, Mfi2

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6479 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

31878810-31899020 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 31881882 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 73 (D73E)

Ref Sequence

ENSEMBL: ENSMUSP00000023464 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023464]

AlphaFold

Q9R0R1

Predicted Effect

probably damaging
Transcript: ENSMUST00000023464
AA Change: D73E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000023464
Gene: ENSMUSG00000022780
AA Change: D73E

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
TR_FER	23	364	2.62e-183	SMART
TR_FER	366	719	4.23e-178	SMART
low complexity region	721	734	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.7%
20x: 92.0%

Validation Efficiency

95% (55/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding function has not yet been identified. This gene resides in the same region of chromosome 3 as members of the transferrin superfamily. Alternative splicing results in two transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile, exhibit no physical defects, and develop normally with no detectable alterations in iron metabolism. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam18	A	C	8: 24,629,665	S533A	probably benign	Het
Akap6	T	G	12: 53,141,169	S1789A	probably damaging	Het
Alox15	A	G	11: 70,345,185	S519P	probably damaging	Het
Anapc2	A	G	2: 25,285,395	K816E	probably benign	Het
Atp6v1a	T	C	16: 44,098,758	D488G	probably benign	Het
Banp	A	G	8: 121,991,437		probably null	Het
Camsap1	A	G	2: 25,935,862	C1367R	possibly damaging	Het
Casz1	C	A	4: 148,937,078	H539Q	probably damaging	Het
Ccl5	A	G	11: 83,530,386	Y26H	probably benign	Het
Cops3	A	T	11: 59,833,072	S86R	probably benign	Het
Cts7	A	G	13: 61,355,641	S170P	probably benign	Het
Cxcl15	A	T	5: 90,795,245	E35D	possibly damaging	Het
Dennd1b	C	T	1: 139,041,960		probably benign	Het
Dicer1	T	C	12: 104,696,723	D1533G	probably damaging	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Dock4	A	G	12: 40,828,955	E1531G	probably damaging	Het
Erap1	A	G	13: 74,663,493		probably null	Het
Fsip2	A	G	2: 82,990,086	T5388A	possibly damaging	Het
Gab1	C	A	8: 80,788,597	R364L	possibly damaging	Het
Gm10309	A	T	17: 86,504,579	M1K	probably null	Het
Gm21994	C	T	2: 150,254,591	G306D	probably damaging	Het
Gm4450	T	A	3: 98,446,841	E114V	possibly damaging	Het
Gm4884	A	T	7: 41,040,787	N36Y	probably damaging	Het
Hmcn1	G	A	1: 150,677,302	R2546*	probably null	Het
Hmcn2	A	G	2: 31,425,468	D3743G	probably damaging	Het
Irak2	A	T	6: 113,686,941	N423Y	probably damaging	Het
Jarid2	G	A	13: 44,848,289	G26D	probably benign	Het
Kif13b	A	G	14: 64,751,525	K785R	probably benign	Het
Lamc3	A	T	2: 31,887,401	I20F	probably benign	Het
Limk1	G	A	5: 134,661,519		probably benign	Het
Lrp4	C	T	2: 91,487,084	T851I	probably damaging	Het
Med13	G	A	11: 86,357,527		probably benign	Het
Megf10	T	C	18: 57,246,570	F273L	possibly damaging	Het
Mroh7	A	G	4: 106,703,188	F640L	possibly damaging	Het
Mtor	T	C	4: 148,551,000	S2448P	probably benign	Het
Myo3a	T	C	2: 22,577,865	V377A	probably benign	Het
Myo5b	T	C	18: 74,617,015	V183A	probably damaging	Het
Nedd4l	G	A	18: 65,209,681	R755H	probably damaging	Het
Nrde2	T	C	12: 100,143,948	T275A	probably benign	Het
Olfr658	A	G	7: 104,645,126	I80T	probably benign	Het
Osgepl1	T	C	1: 53,321,543	V381A	probably benign	Het
Pcdha1	C	T	18: 36,931,456	T391I	probably benign	Het
Pdp1	T	C	4: 11,961,327	N328S	probably damaging	Het
Pepd	A	G	7: 35,040,722	E340G	probably benign	Het
Plch1	T	C	3: 63,744,510	T387A	probably benign	Het
Plxnb1	C	A	9: 109,111,665	T1536K	possibly damaging	Het
Rbp7	T	C	4: 149,449,890	T130A	probably benign	Het
Rhot2	A	T	17: 25,841,080	V309E	probably benign	Het
Slc37a1	A	G	17: 31,338,990	I421M	possibly damaging	Het
Slit2	T	A	5: 48,231,989	L585H	probably damaging	Het
Spint4	C	A	2: 164,700,844	A119D	probably benign	Het
Strip2	G	T	6: 29,944,497		probably null	Het
Stxbp4	T	C	11: 90,619,187	Y59C	probably damaging	Het
Syne1	G	A	10: 5,231,679	Q4219*	probably null	Het
Syne1	A	T	10: 5,456,826	I37N	probably damaging	Het
Syne4	G	T	7: 30,316,915	G179*	probably null	Het
Tead1	T	C	7: 112,861,465	V192A	probably benign	Het
Trim37	G	T	11: 87,216,487	E317*	probably null	Het
Wdfy3	A	C	5: 101,913,179	Y1390D	probably damaging	Het
Wdr81	A	G	11: 75,452,105	F779L	possibly damaging	Het

Other mutations in Meltf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01811:Meltf	APN	16	31888985	missense	probably damaging	1.00
IGL02942:Meltf	APN	16	31890778	nonsense	probably null
IGL03340:Meltf	APN	16	31892784	missense	probably damaging	1.00
R0734:Meltf	UTSW	16	31881958	missense	probably damaging	0.99
R1023:Meltf	UTSW	16	31884960	missense	probably damaging	1.00
R1751:Meltf	UTSW	16	31883929	missense	probably damaging	1.00
R1767:Meltf	UTSW	16	31883929	missense	probably damaging	1.00
R1851:Meltf	UTSW	16	31896577	missense	probably benign	0.00
R1900:Meltf	UTSW	16	31881969	critical splice donor site	probably null
R1993:Meltf	UTSW	16	31892622	nonsense	probably null
R3423:Meltf	UTSW	16	31896525	nonsense	probably null
R3425:Meltf	UTSW	16	31896525	nonsense	probably null
R3804:Meltf	UTSW	16	31884998	missense	probably benign	0.23
R4724:Meltf	UTSW	16	31892505	missense	probably benign	0.03
R4976:Meltf	UTSW	16	31894714	missense	probably benign	0.01
R5007:Meltf	UTSW	16	31887562	missense	possibly damaging	0.60
R5058:Meltf	UTSW	16	31887603	splice site	probably null
R5534:Meltf	UTSW	16	31890814	critical splice donor site	probably null
R5661:Meltf	UTSW	16	31881926	missense	possibly damaging	0.65
R6028:Meltf	UTSW	16	31887476	missense	possibly damaging	0.91
R6424:Meltf	UTSW	16	31880262	nonsense	probably null
R6464:Meltf	UTSW	16	31890776	missense	probably benign	0.19
R6525:Meltf	UTSW	16	31888899	nonsense	probably null
R6629:Meltf	UTSW	16	31885076	missense	probably damaging	1.00
R6964:Meltf	UTSW	16	31880162	missense	probably benign	0.41
R7133:Meltf	UTSW	16	31892799	missense	probably damaging	1.00
R7169:Meltf	UTSW	16	31880162	missense	probably benign	0.41
R7198:Meltf	UTSW	16	31883799	missense	possibly damaging	0.61
R7212:Meltf	UTSW	16	31890814	critical splice donor site	probably null
R7246:Meltf	UTSW	16	31894862	missense	probably damaging	1.00
R7407:Meltf	UTSW	16	31894735	missense	probably damaging	1.00
R7424:Meltf	UTSW	16	31884946	missense	probably damaging	1.00
R7475:Meltf	UTSW	16	31881938	missense	probably benign	0.12
R7727:Meltf	UTSW	16	31883794	missense	probably damaging	0.99
R7764:Meltf	UTSW	16	31880267	missense	probably benign	0.01
R8220:Meltf	UTSW	16	31887415	missense	probably benign	0.01
R8840:Meltf	UTSW	16	31897202	missense	probably damaging	0.98
R8896:Meltf	UTSW	16	31890704	splice site	probably benign
R9214:Meltf	UTSW	16	31878945	missense	probably benign
R9563:Meltf	UTSW	16	31885051	missense	probably damaging	1.00
R9638:Meltf	UTSW	16	31887591	missense	possibly damaging	0.87
X0062:Meltf	UTSW	16	31880200	missense	probably damaging	1.00
Z1177:Meltf	UTSW	16	31880234	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGAGGTCTTGGCCTGATAAAG -3'
(R):5'- ACAGACTCAGCTTGCCAGTC -3'

Sequencing Primer
(F):5'- CTGATAAAGGAAGCCCTGGG -3'
(R):5'- TGGACCCCCAGAAGAGTTCTATG -3'

Posted On

2018-05-21