Incidental Mutation 'R6480:Ndufs2'
ID517012
Institutional Source Beutler Lab
Gene Symbol Ndufs2
Ensembl Gene ENSMUSG00000013593
Gene NameNADH dehydrogenase (ubiquinone) Fe-S protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6480 (G1)
Quality Score184.009
Status Validated
Chromosome1
Chromosomal Location171234853-171251388 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 171236698 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 348 (S348P)
Ref Sequence ENSEMBL: ENSMUSP00000106950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013737] [ENSMUST00000079957] [ENSMUST00000111318] [ENSMUST00000191871] [ENSMUST00000193973] [ENSMUST00000194778]
Predicted Effect probably damaging
Transcript: ENSMUST00000013737
AA Change: S374P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000013737
Gene: ENSMUSG00000013593
AA Change: S374P

DomainStartEndE-ValueType
Pfam:Complex1_49kDa 193 463 1.1e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079957
SMART Domains Protein: ENSMUSP00000078875
Gene: ENSMUSG00000058715

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:TCR_zetazeta 21 51 3.7e-19 PFAM
ITAM 62 82 9.62e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111318
AA Change: S348P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106950
Gene: ENSMUSG00000013593
AA Change: S348P

DomainStartEndE-ValueType
Pfam:Complex1_49kDa 193 236 2e-21 PFAM
Pfam:Complex1_49kDa 232 437 1.7e-105 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131286
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136976
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150997
Predicted Effect probably benign
Transcript: ENSMUST00000191871
SMART Domains Protein: ENSMUSP00000141942
Gene: ENSMUSG00000013593

DomainStartEndE-ValueType
Pfam:Complex1_49kDa 114 146 5.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193973
SMART Domains Protein: ENSMUSP00000141240
Gene: ENSMUSG00000058715

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:TCR_zetazeta 21 53 4.7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194778
SMART Domains Protein: ENSMUSP00000141370
Gene: ENSMUSG00000013593

DomainStartEndE-ValueType
Pfam:Complex1_49kDa 166 231 3.4e-28 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a core subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (complex I). Mammalian mitochondrial complex I is composed of at least 43 different subunits, 7 of which are encoded by the mitochondrial genome, and the rest are the products of nuclear genes. The iron-sulfur protein fraction of complex I is made up of 7 subunits, including this gene product. Complex I catalyzes the NADH oxidation with concomitant ubiquinone reduction and proton ejection out of the mitochondria. Mutations in this gene are associated with mitochondrial complex I deficiency. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl8b T A 6: 108,815,049 N90K possibly damaging Het
Art3 T C 5: 92,392,817 F140L probably damaging Het
Ascc3 T A 10: 50,710,953 M967K probably damaging Het
Ccne1 G A 7: 38,106,854 probably benign Het
Cdc14b T C 13: 64,225,650 probably null Het
Ceacam2 T A 7: 25,519,989 E282V probably damaging Het
Clk4 T A 11: 51,270,546 C86* probably null Het
Cul2 A C 18: 3,417,561 K115T possibly damaging Het
Dhx29 A T 13: 112,953,788 K800* probably null Het
Dlec1 T C 9: 119,147,690 F1741S probably benign Het
Dnah12 A G 14: 26,872,455 T3455A probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drd4 A T 7: 141,294,793 I366F possibly damaging Het
Fam169b T A 7: 68,353,718 Y273* probably null Het
Fbn1 T A 2: 125,335,418 Y1833F probably benign Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gjb6 T C 14: 57,124,442 I121V probably benign Het
Glg1 T C 8: 111,197,706 T217A possibly damaging Het
Igkv5-48 A G 6: 69,726,826 S32P probably benign Het
Itgax C A 7: 128,148,599 F1062L probably benign Het
Lct G A 1: 128,294,320 T1494I probably damaging Het
Lilra6 G A 7: 3,912,933 T309I probably damaging Het
Mical3 T C 6: 121,034,275 T321A possibly damaging Het
Mmp23 T A 4: 155,652,341 N104I probably damaging Het
Muc3 T C 5: 137,142,390 Y131C probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Nepro T C 16: 44,727,075 S52P probably damaging Het
Nlrp6 A G 7: 140,927,443 E874G possibly damaging Het
Nsmce1 A G 7: 125,491,418 V9A probably benign Het
Olfr13 T C 6: 43,174,066 F27L probably benign Het
Olfr1458 T A 19: 13,102,474 T277S probably benign Het
Olfr357 T C 2: 36,996,995 F62L probably benign Het
Olfr788 A T 10: 129,472,721 I10F possibly damaging Het
Per2 A T 1: 91,429,382 probably null Het
Pgbd1 T C 13: 21,423,476 I183V probably benign Het
Pik3c2g T C 6: 139,730,469 V113A probably benign Het
Pipox A G 11: 77,882,648 L259P probably damaging Het
Pkd1l3 C T 8: 109,638,387 Q1124* probably null Het
Plcd3 A G 11: 103,074,931 S492P possibly damaging Het
Rcor2 T G 19: 7,271,046 M142R probably benign Het
Rwdd3 T C 3: 121,156,452 E115G probably damaging Het
Slc13a3 T C 2: 165,408,898 Y475C probably damaging Het
Slc14a2 A T 18: 78,159,082 I611N possibly damaging Het
Slc25a24 G T 3: 109,136,301 M91I probably damaging Het
Spg11 T C 2: 122,092,305 S888G probably benign Het
Spta1 A T 1: 174,187,148 probably null Het
Stk35 C A 2: 129,810,687 D369E possibly damaging Het
Tanc1 T C 2: 59,807,642 S889P probably damaging Het
Tbc1d10b T C 7: 127,198,878 N697S probably damaging Het
Tcof1 A T 18: 60,814,780 probably null Het
Tg T A 15: 66,671,311 Y25N probably damaging Het
Thbs1 T C 2: 118,119,117 C563R probably damaging Het
Tlr11 A G 14: 50,363,055 S833G possibly damaging Het
Uggt2 T A 14: 119,057,564 H550L probably benign Het
Utp20 A G 10: 88,755,186 probably null Het
Wbp1l T A 19: 46,654,319 L253Q probably damaging Het
Zfp433 T A 10: 81,720,244 S161R possibly damaging Het
Zfp865 A G 7: 5,029,783 T256A probably damaging Het
Zpr1 A G 9: 46,274,711 D160G probably benign Het
Other mutations in Ndufs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01959:Ndufs2 APN 1 171237229 missense probably benign 0.45
IGL02367:Ndufs2 APN 1 171239365 nonsense probably null
R0905:Ndufs2 UTSW 1 171236353 unclassified probably null
R1618:Ndufs2 UTSW 1 171246121 missense probably benign 0.19
R3788:Ndufs2 UTSW 1 171235320 missense possibly damaging 0.81
R4866:Ndufs2 UTSW 1 171247049 missense probably benign 0.05
R4959:Ndufs2 UTSW 1 171238009 missense probably damaging 1.00
R5788:Ndufs2 UTSW 1 171239385 missense probably damaging 1.00
R5992:Ndufs2 UTSW 1 171236418 missense probably damaging 1.00
R6141:Ndufs2 UTSW 1 171236616 missense probably damaging 1.00
R6419:Ndufs2 UTSW 1 171241099 missense probably benign 0.12
R7034:Ndufs2 UTSW 1 171238308 missense probably benign 0.22
R7036:Ndufs2 UTSW 1 171238308 missense probably benign 0.22
R7854:Ndufs2 UTSW 1 171239369 missense probably damaging 1.00
R7937:Ndufs2 UTSW 1 171239369 missense probably damaging 1.00
R8023:Ndufs2 UTSW 1 171236694 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACACCTCTGTGAGCAGTGAG -3'
(R):5'- AGAGCTTGGATCTGGTTTCC -3'

Sequencing Primer
(F):5'- AGGGAGTGCTTCGTTCCC -3'
(R):5'- AGAGCTTGGATCTGGTTTCCTTCTG -3'
Posted On2018-05-21