Incidental Mutation 'R6480:Slc13a3'
ID517020
Institutional Source Beutler Lab
Gene Symbol Slc13a3
Ensembl Gene ENSMUSG00000018459
Gene Namesolute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3
SynonymsSDCT2, NaDC-3, NaDC3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6480 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location165405028-165473230 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 165408898 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 475 (Y475C)
Ref Sequence ENSEMBL: ENSMUSP00000104902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029208] [ENSMUST00000109279]
Predicted Effect probably damaging
Transcript: ENSMUST00000029208
AA Change: Y517C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029208
Gene: ENSMUSG00000018459
AA Change: Y517C

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 9 571 2.6e-110 PFAM
Pfam:CitMHS 43 167 1.4e-15 PFAM
Pfam:CitMHS 221 486 5.3e-18 PFAM
low complexity region 578 596 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109279
AA Change: Y475C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104902
Gene: ENSMUSG00000018459
AA Change: Y475C

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 9 270 6.7e-49 PFAM
Pfam:Na_sulph_symp 265 529 1.9e-51 PFAM
low complexity region 536 554 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145513
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian sodium-dicarboxylate cotransporters transport succinate and other Krebs cycle intermediates. They fall into 2 categories based on their substrate affinity: low affinity and high affinity. Both the low- and high-affinity transporters play an important role in the handling of citrate by the kidneys. The protein encoded by this gene represents the high-affinity form. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, although the full-length nature of some of them have not been characterized yet. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl8b T A 6: 108,815,049 N90K possibly damaging Het
Art3 T C 5: 92,392,817 F140L probably damaging Het
Ascc3 T A 10: 50,710,953 M967K probably damaging Het
Ccne1 G A 7: 38,106,854 probably benign Het
Cdc14b T C 13: 64,225,650 probably null Het
Ceacam2 T A 7: 25,519,989 E282V probably damaging Het
Clk4 T A 11: 51,270,546 C86* probably null Het
Cul2 A C 18: 3,417,561 K115T possibly damaging Het
Dhx29 A T 13: 112,953,788 K800* probably null Het
Dlec1 T C 9: 119,147,690 F1741S probably benign Het
Dnah12 A G 14: 26,872,455 T3455A probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drd4 A T 7: 141,294,793 I366F possibly damaging Het
Fam169b T A 7: 68,353,718 Y273* probably null Het
Fbn1 T A 2: 125,335,418 Y1833F probably benign Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gjb6 T C 14: 57,124,442 I121V probably benign Het
Glg1 T C 8: 111,197,706 T217A possibly damaging Het
Igkv5-48 A G 6: 69,726,826 S32P probably benign Het
Itgax C A 7: 128,148,599 F1062L probably benign Het
Lct G A 1: 128,294,320 T1494I probably damaging Het
Lilra6 G A 7: 3,912,933 T309I probably damaging Het
Mical3 T C 6: 121,034,275 T321A possibly damaging Het
Mmp23 T A 4: 155,652,341 N104I probably damaging Het
Muc3 T C 5: 137,142,390 Y131C probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Ndufs2 A G 1: 171,236,698 S348P probably damaging Het
Nepro T C 16: 44,727,075 S52P probably damaging Het
Nlrp6 A G 7: 140,927,443 E874G possibly damaging Het
Nsmce1 A G 7: 125,491,418 V9A probably benign Het
Olfr13 T C 6: 43,174,066 F27L probably benign Het
Olfr1458 T A 19: 13,102,474 T277S probably benign Het
Olfr357 T C 2: 36,996,995 F62L probably benign Het
Olfr788 A T 10: 129,472,721 I10F possibly damaging Het
Per2 A T 1: 91,429,382 probably null Het
Pgbd1 T C 13: 21,423,476 I183V probably benign Het
Pik3c2g T C 6: 139,730,469 V113A probably benign Het
Pipox A G 11: 77,882,648 L259P probably damaging Het
Pkd1l3 C T 8: 109,638,387 Q1124* probably null Het
Plcd3 A G 11: 103,074,931 S492P possibly damaging Het
Rcor2 T G 19: 7,271,046 M142R probably benign Het
Rwdd3 T C 3: 121,156,452 E115G probably damaging Het
Slc14a2 A T 18: 78,159,082 I611N possibly damaging Het
Slc25a24 G T 3: 109,136,301 M91I probably damaging Het
Spg11 T C 2: 122,092,305 S888G probably benign Het
Spta1 A T 1: 174,187,148 probably null Het
Stk35 C A 2: 129,810,687 D369E possibly damaging Het
Tanc1 T C 2: 59,807,642 S889P probably damaging Het
Tbc1d10b T C 7: 127,198,878 N697S probably damaging Het
Tcof1 A T 18: 60,814,780 probably null Het
Tg T A 15: 66,671,311 Y25N probably damaging Het
Thbs1 T C 2: 118,119,117 C563R probably damaging Het
Tlr11 A G 14: 50,363,055 S833G possibly damaging Het
Uggt2 T A 14: 119,057,564 H550L probably benign Het
Utp20 A G 10: 88,755,186 probably null Het
Wbp1l T A 19: 46,654,319 L253Q probably damaging Het
Zfp433 T A 10: 81,720,244 S161R possibly damaging Het
Zfp865 A G 7: 5,029,783 T256A probably damaging Het
Zpr1 A G 9: 46,274,711 D160G probably benign Het
Other mutations in Slc13a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Slc13a3 APN 2 165411923 missense probably damaging 1.00
IGL00326:Slc13a3 APN 2 165473097 missense possibly damaging 0.89
IGL01308:Slc13a3 APN 2 165406780 missense probably damaging 0.99
IGL01668:Slc13a3 APN 2 165430292 missense probably damaging 1.00
IGL02435:Slc13a3 APN 2 165408940 missense possibly damaging 0.95
IGL02551:Slc13a3 APN 2 165424573 missense probably damaging 1.00
IGL02716:Slc13a3 APN 2 165406715 missense unknown
IGL03107:Slc13a3 APN 2 165437307 missense probably benign 0.00
R0114:Slc13a3 UTSW 2 165424581 missense probably damaging 1.00
R0624:Slc13a3 UTSW 2 165411887 missense probably damaging 1.00
R1051:Slc13a3 UTSW 2 165408820 critical splice donor site probably null
R1780:Slc13a3 UTSW 2 165406699 missense unknown
R1782:Slc13a3 UTSW 2 165445519 missense probably benign 0.01
R1994:Slc13a3 UTSW 2 165434064 missense possibly damaging 0.90
R4739:Slc13a3 UTSW 2 165430289 missense possibly damaging 0.91
R4971:Slc13a3 UTSW 2 165448699 missense probably damaging 0.99
R5091:Slc13a3 UTSW 2 165420080 missense probably benign 0.11
R5093:Slc13a3 UTSW 2 165411896 missense probably damaging 1.00
R5826:Slc13a3 UTSW 2 165408956 missense probably benign 0.05
R5894:Slc13a3 UTSW 2 165424623 missense probably benign 0.00
R6239:Slc13a3 UTSW 2 165406697 missense unknown
R6394:Slc13a3 UTSW 2 165434097 missense probably damaging 1.00
R6453:Slc13a3 UTSW 2 165411947 missense possibly damaging 0.94
R6463:Slc13a3 UTSW 2 165445653 missense probably damaging 1.00
R6525:Slc13a3 UTSW 2 165406747 missense unknown
R6879:Slc13a3 UTSW 2 165430301 missense probably damaging 1.00
R7278:Slc13a3 UTSW 2 165445528 missense possibly damaging 0.87
R7340:Slc13a3 UTSW 2 165430290 missense probably benign 0.00
R7404:Slc13a3 UTSW 2 165434064 missense possibly damaging 0.90
R7452:Slc13a3 UTSW 2 165427114 missense probably benign 0.03
R7585:Slc13a3 UTSW 2 165430322 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTAGTGGGAAGATTCACATGGGAC -3'
(R):5'- CTAAAATTGCATGTCATGTGTGGTG -3'

Sequencing Primer
(F):5'- CATGGAAGAGACTGGCAATGCTG -3'
(R):5'- GTGTCTATCTACACGTCTGTCTCTG -3'
Posted On2018-05-21