Mutagenetix > Incidental Mutation

Incidental Mutation 'R6480:Nlrp6'

517039

Institutional Source

Beutler Lab

Gene Symbol

Nlrp6

Ensembl Gene

ENSMUSG00000038745

Gene Name

NLR family, pyrin domain containing 6

Synonyms

Nalp6

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R6480 (G1)

Quality Score

181.009

Status

Validated

Chromosome

Chromosomal Location

140920902-140929192 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 140927443 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 874 (E874G)

Ref Sequence

ENSEMBL: ENSMUSP00000139170 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106045] [ENSMUST00000183845] [ENSMUST00000184560]

AlphaFold

Q91WS2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106045
AA Change: E857G

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000101660
Gene: ENSMUSG00000038745
AA Change: E857G

Domain	Start	End	E-Value	Type
PYRIN	15	96	5.44e-27	SMART
low complexity region	158	169	N/A	INTRINSIC
Pfam:NACHT	194	363	8.6e-44	PFAM
coiled coil region	590	617	N/A	INTRINSIC
low complexity region	675	697	N/A	INTRINSIC
internal_repeat_1	715	763	9.43e-6	PROSPERO
internal_repeat_1	828	876	9.43e-6	PROSPERO

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183761

Predicted Effect

probably benign
Transcript: ENSMUST00000183845
AA Change: E844G

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000139357
Gene: ENSMUSG00000038745
AA Change: E844G

Domain	Start	End	E-Value	Type
PYRIN	15	96	5.44e-27	SMART
low complexity region	158	169	N/A	INTRINSIC
Pfam:NACHT	194	363	5.5e-43	PFAM
coiled coil region	590	617	N/A	INTRINSIC
low complexity region	680	694	N/A	INTRINSIC
internal_repeat_1	702	750	1.26e-5	PROSPERO
internal_repeat_1	815	863	1.26e-5	PROSPERO

Predicted Effect

possibly damaging
Transcript: ENSMUST00000184560
AA Change: E874G

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000139170
Gene: ENSMUSG00000038745
AA Change: E874G

Domain	Start	End	E-Value	Type
PYRIN	45	126	5.44e-27	SMART
low complexity region	188	199	N/A	INTRINSIC
Pfam:NACHT	224	393	8.2e-43	PFAM
coiled coil region	620	647	N/A	INTRINSIC
low complexity region	710	724	N/A	INTRINSIC
internal_repeat_1	732	780	1.55e-5	PROSPERO
internal_repeat_1	845	893	1.55e-5	PROSPERO

Meta Mutation Damage Score

0.1010

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.4%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: The protein encoded by this gene binds arginine-vasopressin and may be involved in the arginine-vasopressin-mediated regulation of renal salt-water balance. The encoded protein also mediates inflammatory responses in the colon to allow recovery from intestinal epithelial damage and protects against tumorigenesis and the development of colitis. Finally, this protein can increase activation of NF-kappa-B, activation of CASP1 through interaction with ASC, and cAMP accumulation. [provided by RefSeq, Feb 2013]
PHENOTYPE: Nullizygous mutations lead to altered colonic microbiota, increased susceptibility to induced colitis and/or inflammation-associated colon tumorigenesis. Homozygotes for a null allele show lower blood pressure and sex-specific changes in urine concentrating ability, cognition, and anxiety behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arl8b	T	A	6: 108,815,049	N90K	possibly damaging	Het
Art3	T	C	5: 92,392,817	F140L	probably damaging	Het
Ascc3	T	A	10: 50,710,953	M967K	probably damaging	Het
Ccne1	G	A	7: 38,106,854		probably benign	Het
Cdc14b	T	C	13: 64,225,650		probably null	Het
Ceacam2	T	A	7: 25,519,989	E282V	probably damaging	Het
Clk4	T	A	11: 51,270,546	C86*	probably null	Het
Cul2	A	C	18: 3,417,561	K115T	possibly damaging	Het
Dhx29	A	T	13: 112,953,788	K800*	probably null	Het
Dlec1	T	C	9: 119,147,690	F1741S	probably benign	Het
Dnah12	A	G	14: 26,872,455	T3455A	probably damaging	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Drd4	A	T	7: 141,294,793	I366F	possibly damaging	Het
Fam169b	T	A	7: 68,353,718	Y273*	probably null	Het
Fbn1	T	A	2: 125,335,418	Y1833F	probably benign	Het
Fsip2	A	G	2: 82,990,086	T5388A	possibly damaging	Het
Gjb6	T	C	14: 57,124,442	I121V	probably benign	Het
Glg1	T	C	8: 111,197,706	T217A	possibly damaging	Het
Igkv5-48	A	G	6: 69,726,826	S32P	probably benign	Het
Itgax	C	A	7: 128,148,599	F1062L	probably benign	Het
Lct	G	A	1: 128,294,320	T1494I	probably damaging	Het
Lilra6	G	A	7: 3,912,933	T309I	probably damaging	Het
Mical3	T	C	6: 121,034,275	T321A	possibly damaging	Het
Mmp23	T	A	4: 155,652,341	N104I	probably damaging	Het
Muc3	T	C	5: 137,142,390	Y131C		Het
Naip2	A	C	13: 100,162,041	S496A	probably benign	Het
Ndufs2	A	G	1: 171,236,698	S348P	probably damaging	Het
Nepro	T	C	16: 44,727,075	S52P	probably damaging	Het
Nsmce1	A	G	7: 125,491,418	V9A	probably benign	Het
Olfr13	T	C	6: 43,174,066	F27L	probably benign	Het
Olfr1458	T	A	19: 13,102,474	T277S	probably benign	Het
Olfr357	T	C	2: 36,996,995	F62L	probably benign	Het
Olfr788	A	T	10: 129,472,721	I10F	possibly damaging	Het
Per2	A	T	1: 91,429,382		probably null	Het
Pgbd1	T	C	13: 21,423,476	I183V	probably benign	Het
Pik3c2g	T	C	6: 139,730,469	V113A	probably benign	Het
Pipox	A	G	11: 77,882,648	L259P	probably damaging	Het
Pkd1l3	C	T	8: 109,638,387	Q1124*	probably null	Het
Plcd3	A	G	11: 103,074,931	S492P	possibly damaging	Het
Rcor2	T	G	19: 7,271,046	M142R	probably benign	Het
Rwdd3	T	C	3: 121,156,452	E115G	probably damaging	Het
Slc13a3	T	C	2: 165,408,898	Y475C	probably damaging	Het
Slc14a2	A	T	18: 78,159,082	I611N	possibly damaging	Het
Slc25a24	G	T	3: 109,136,301	M91I	probably damaging	Het
Spg11	T	C	2: 122,092,305	S888G	probably benign	Het
Spta1	A	T	1: 174,187,148		probably null	Het
Stk35	C	A	2: 129,810,687	D369E	possibly damaging	Het
Tanc1	T	C	2: 59,807,642	S889P	probably damaging	Het
Tbc1d10b	T	C	7: 127,198,878	N697S	probably damaging	Het
Tcof1	A	T	18: 60,814,780		probably null	Het
Tg	T	A	15: 66,671,311	Y25N	probably damaging	Het
Thbs1	T	C	2: 118,119,117	C563R	probably damaging	Het
Tlr11	A	G	14: 50,363,055	S833G	possibly damaging	Het
Uggt2	T	A	14: 119,057,564	H550L	probably benign	Het
Utp20	A	G	10: 88,755,186		probably null	Het
Wbp1l	T	A	19: 46,654,319	L253Q	probably damaging	Het
Zfp433	T	A	10: 81,720,244	S161R	possibly damaging	Het
Zfp865	A	G	7: 5,029,783	T256A	probably damaging	Het
Zpr1	A	G	9: 46,274,711	D160G	probably benign	Het

Other mutations in Nlrp6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00561:Nlrp6	APN	7	140923124	missense	probably damaging	1.00
IGL01066:Nlrp6	APN	7	140921796	missense	possibly damaging	0.88
IGL01966:Nlrp6	APN	7	140925190	missense	probably damaging	1.00
IGL02625:Nlrp6	APN	7	140923500	missense	probably benign	0.00
IGL02792:Nlrp6	APN	7	140922435	missense	probably damaging	0.97
IGL02813:Nlrp6	APN	7	140923420	missense	possibly damaging	0.86
IGL03140:Nlrp6	APN	7	140927487	missense	probably benign	0.01
R0608:Nlrp6	UTSW	7	140923486	nonsense	probably null
R1404:Nlrp6	UTSW	7	140924113	small deletion	probably benign
R1404:Nlrp6	UTSW	7	140924113	small deletion	probably benign
R1472:Nlrp6	UTSW	7	140923495	missense	probably damaging	1.00
R1587:Nlrp6	UTSW	7	140923046	missense	probably damaging	1.00
R1843:Nlrp6	UTSW	7	140923093	missense	probably damaging	1.00
R1959:Nlrp6	UTSW	7	140924113	small deletion	probably benign
R2097:Nlrp6	UTSW	7	140923204	missense	probably damaging	1.00
R2118:Nlrp6	UTSW	7	140926444	missense	probably benign	0.11
R2119:Nlrp6	UTSW	7	140926444	missense	probably benign	0.11
R2120:Nlrp6	UTSW	7	140926444	missense	probably benign	0.11
R2121:Nlrp6	UTSW	7	140926444	missense	probably benign	0.11
R2290:Nlrp6	UTSW	7	140922163	missense	probably damaging	1.00
R3546:Nlrp6	UTSW	7	140926769	missense	probably benign	0.00
R3547:Nlrp6	UTSW	7	140926769	missense	probably benign	0.00
R3970:Nlrp6	UTSW	7	140921655	missense	probably damaging	1.00
R4483:Nlrp6	UTSW	7	140921781	missense	probably damaging	1.00
R4484:Nlrp6	UTSW	7	140921781	missense	probably damaging	1.00
R4869:Nlrp6	UTSW	7	140924093	missense	probably damaging	1.00
R4962:Nlrp6	UTSW	7	140923584	missense	probably damaging	0.99
R5436:Nlrp6	UTSW	7	140922717	nonsense	probably null
R5442:Nlrp6	UTSW	7	140922190	missense	probably benign	0.01
R5924:Nlrp6	UTSW	7	140923490	missense	probably damaging	1.00
R5936:Nlrp6	UTSW	7	140922812	nonsense	probably null
R6124:Nlrp6	UTSW	7	140923247	missense	probably damaging	1.00
R6455:Nlrp6	UTSW	7	140927509	missense	possibly damaging	0.65
R6873:Nlrp6	UTSW	7	140923520	missense	probably benign	0.01
R7061:Nlrp6	UTSW	7	140922867	missense	probably benign	0.36
R7350:Nlrp6	UTSW	7	140921278	start gained	probably benign
R7532:Nlrp6	UTSW	7	140925184	missense	probably benign	0.00
R7752:Nlrp6	UTSW	7	140927440	missense	possibly damaging	0.92
R7901:Nlrp6	UTSW	7	140927440	missense	possibly damaging	0.92
R8098:Nlrp6	UTSW	7	140923255	missense	probably damaging	1.00
R8381:Nlrp6	UTSW	7	140923841	missense	possibly damaging	0.47
R8513:Nlrp6	UTSW	7	140922830	missense	possibly damaging	0.83
R9114:Nlrp6	UTSW	7	140926419	missense	probably damaging	1.00
V7732:Nlrp6	UTSW	7	140926648	splice site	probably benign
Z1176:Nlrp6	UTSW	7	140922721	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAACTGACTGTCTTCTGGTAC -3'
(R):5'- CTTGAAAGACTTGCCTGGAGGG -3'

Sequencing Primer
(F):5'- GGTACTTGTCAAATCCTAATCAGAC -3'
(R):5'- AGAAGCTGGCATCTTCTTGC -3'

Posted On

2018-05-21