Incidental Mutation 'R6480:Drd4'
ID517040
Institutional Source Beutler Lab
Gene Symbol Drd4
Ensembl Gene ENSMUSG00000025496
Gene Namedopamine receptor D4
SynonymsD4R, Drd-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6480 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location141292006-141296464 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 141294793 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 366 (I366F)
Ref Sequence ENSEMBL: ENSMUSP00000026569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026569] [ENSMUST00000080553] [ENSMUST00000211146]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026569
AA Change: I366F

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000026569
Gene: ENSMUSG00000025496
AA Change: I366F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 40 182 9.6e-9 PFAM
Pfam:7tm_1 48 368 1.8e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080553
SMART Domains Protein: ENSMUSP00000079395
Gene: ENSMUSG00000058886

DomainStartEndE-ValueType
SCOP:d1gkub1 6 35 9e-3 SMART
low complexity region 43 68 N/A INTRINSIC
low complexity region 88 105 N/A INTRINSIC
low complexity region 167 186 N/A INTRINSIC
SAND 202 274 9.78e-40 SMART
low complexity region 277 286 N/A INTRINSIC
low complexity region 324 338 N/A INTRINSIC
Pfam:zf-MYND 505 541 8.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209600
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209649
Predicted Effect probably benign
Transcript: ENSMUST00000210062
Predicted Effect probably benign
Transcript: ENSMUST00000211146
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the D4 subtype of the dopamine receptor. The D4 subtype is a G-protein coupled receptor which inhibits adenylyl cyclase. It is a target for drugs which treat schizophrenia and Parkinson disease. Mutations in this gene have been associated with various behavioral phenotypes, including autonomic nervous system dysfunction, attention deficit/hyperactivity disorder, and the personality trait of novelty seeking. This gene contains a polymorphic number (2-10 copies) of tandem 48 nt repeats; the sequence shown contains four repeats. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants are less active in open field tests and have reduced responses to novelty. However, mice exhibit locomotor supersensitivity to ethanol, cocaine, and methamphetamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl8b T A 6: 108,815,049 N90K possibly damaging Het
Art3 T C 5: 92,392,817 F140L probably damaging Het
Ascc3 T A 10: 50,710,953 M967K probably damaging Het
Ccne1 G A 7: 38,106,854 probably benign Het
Cdc14b T C 13: 64,225,650 probably null Het
Ceacam2 T A 7: 25,519,989 E282V probably damaging Het
Clk4 T A 11: 51,270,546 C86* probably null Het
Cul2 A C 18: 3,417,561 K115T possibly damaging Het
Dhx29 A T 13: 112,953,788 K800* probably null Het
Dlec1 T C 9: 119,147,690 F1741S probably benign Het
Dnah12 A G 14: 26,872,455 T3455A probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fam169b T A 7: 68,353,718 Y273* probably null Het
Fbn1 T A 2: 125,335,418 Y1833F probably benign Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gjb6 T C 14: 57,124,442 I121V probably benign Het
Glg1 T C 8: 111,197,706 T217A possibly damaging Het
Igkv5-48 A G 6: 69,726,826 S32P probably benign Het
Itgax C A 7: 128,148,599 F1062L probably benign Het
Lct G A 1: 128,294,320 T1494I probably damaging Het
Lilra6 G A 7: 3,912,933 T309I probably damaging Het
Mical3 T C 6: 121,034,275 T321A possibly damaging Het
Mmp23 T A 4: 155,652,341 N104I probably damaging Het
Muc3 T C 5: 137,142,390 Y131C probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Ndufs2 A G 1: 171,236,698 S348P probably damaging Het
Nepro T C 16: 44,727,075 S52P probably damaging Het
Nlrp6 A G 7: 140,927,443 E874G possibly damaging Het
Nsmce1 A G 7: 125,491,418 V9A probably benign Het
Olfr13 T C 6: 43,174,066 F27L probably benign Het
Olfr1458 T A 19: 13,102,474 T277S probably benign Het
Olfr357 T C 2: 36,996,995 F62L probably benign Het
Olfr788 A T 10: 129,472,721 I10F possibly damaging Het
Per2 A T 1: 91,429,382 probably null Het
Pgbd1 T C 13: 21,423,476 I183V probably benign Het
Pik3c2g T C 6: 139,730,469 V113A probably benign Het
Pipox A G 11: 77,882,648 L259P probably damaging Het
Pkd1l3 C T 8: 109,638,387 Q1124* probably null Het
Plcd3 A G 11: 103,074,931 S492P possibly damaging Het
Rcor2 T G 19: 7,271,046 M142R probably benign Het
Rwdd3 T C 3: 121,156,452 E115G probably damaging Het
Slc13a3 T C 2: 165,408,898 Y475C probably damaging Het
Slc14a2 A T 18: 78,159,082 I611N possibly damaging Het
Slc25a24 G T 3: 109,136,301 M91I probably damaging Het
Spg11 T C 2: 122,092,305 S888G probably benign Het
Spta1 A T 1: 174,187,148 probably null Het
Stk35 C A 2: 129,810,687 D369E possibly damaging Het
Tanc1 T C 2: 59,807,642 S889P probably damaging Het
Tbc1d10b T C 7: 127,198,878 N697S probably damaging Het
Tcof1 A T 18: 60,814,780 probably null Het
Tg T A 15: 66,671,311 Y25N probably damaging Het
Thbs1 T C 2: 118,119,117 C563R probably damaging Het
Tlr11 A G 14: 50,363,055 S833G possibly damaging Het
Uggt2 T A 14: 119,057,564 H550L probably benign Het
Utp20 A G 10: 88,755,186 probably null Het
Wbp1l T A 19: 46,654,319 L253Q probably damaging Het
Zfp433 T A 10: 81,720,244 S161R possibly damaging Het
Zfp865 A G 7: 5,029,783 T256A probably damaging Het
Zpr1 A G 9: 46,274,711 D160G probably benign Het
Other mutations in Drd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Drd4 APN 7 141292183 missense probably damaging 1.00
IGL01542:Drd4 APN 7 141293831 unclassified probably benign
R2314:Drd4 UTSW 7 141293941 missense probably damaging 1.00
R2484:Drd4 UTSW 7 141294736 missense probably benign
R3054:Drd4 UTSW 7 141294479 missense probably damaging 0.99
R3055:Drd4 UTSW 7 141294479 missense probably damaging 0.99
R3108:Drd4 UTSW 7 141292282 missense possibly damaging 0.95
R3109:Drd4 UTSW 7 141292282 missense possibly damaging 0.95
R4597:Drd4 UTSW 7 141294479 missense probably damaging 0.99
R4964:Drd4 UTSW 7 141293777 missense probably damaging 1.00
R4966:Drd4 UTSW 7 141293777 missense probably damaging 1.00
R5474:Drd4 UTSW 7 141293728 missense probably damaging 1.00
R6010:Drd4 UTSW 7 141294796 missense probably damaging 1.00
R7206:Drd4 UTSW 7 141292119 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGGCAATGAGAGTCCTGCC -3'
(R):5'- CCCCAGCCTTCATAAGTGGTTAG -3'

Sequencing Primer
(F):5'- AATGAGAGTCCTGCCGGTGG -3'
(R):5'- CCAGCCTTCATAAGTGGTTAGAAAAG -3'
Posted On2018-05-21