Incidental Mutation 'R6480:Olfr788'
ID517048
Institutional Source Beutler Lab
Gene Symbol Olfr788
Ensembl Gene ENSMUSG00000049217
Gene Nameolfactory receptor 788
SynonymsMOR111-4, GA_x6K02T2PULF-11151514-11152449
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R6480 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location129470998-129476618 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129472721 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 10 (I10F)
Ref Sequence ENSEMBL: ENSMUSP00000151054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056961] [ENSMUST00000213222]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056961
AA Change: I10F

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000054710
Gene: ENSMUSG00000049217
AA Change: I10F

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 1.8e-49 PFAM
Pfam:7tm_1 38 287 1.2e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213222
AA Change: I10F

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl8b T A 6: 108,815,049 N90K possibly damaging Het
Art3 T C 5: 92,392,817 F140L probably damaging Het
Ascc3 T A 10: 50,710,953 M967K probably damaging Het
Ccne1 G A 7: 38,106,854 probably benign Het
Cdc14b T C 13: 64,225,650 probably null Het
Ceacam2 T A 7: 25,519,989 E282V probably damaging Het
Clk4 T A 11: 51,270,546 C86* probably null Het
Cul2 A C 18: 3,417,561 K115T possibly damaging Het
Dhx29 A T 13: 112,953,788 K800* probably null Het
Dlec1 T C 9: 119,147,690 F1741S probably benign Het
Dnah12 A G 14: 26,872,455 T3455A probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drd4 A T 7: 141,294,793 I366F possibly damaging Het
Fam169b T A 7: 68,353,718 Y273* probably null Het
Fbn1 T A 2: 125,335,418 Y1833F probably benign Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gjb6 T C 14: 57,124,442 I121V probably benign Het
Glg1 T C 8: 111,197,706 T217A possibly damaging Het
Igkv5-48 A G 6: 69,726,826 S32P probably benign Het
Itgax C A 7: 128,148,599 F1062L probably benign Het
Lct G A 1: 128,294,320 T1494I probably damaging Het
Lilra6 G A 7: 3,912,933 T309I probably damaging Het
Mical3 T C 6: 121,034,275 T321A possibly damaging Het
Mmp23 T A 4: 155,652,341 N104I probably damaging Het
Muc3 T C 5: 137,142,390 Y131C probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Ndufs2 A G 1: 171,236,698 S348P probably damaging Het
Nepro T C 16: 44,727,075 S52P probably damaging Het
Nlrp6 A G 7: 140,927,443 E874G possibly damaging Het
Nsmce1 A G 7: 125,491,418 V9A probably benign Het
Olfr13 T C 6: 43,174,066 F27L probably benign Het
Olfr1458 T A 19: 13,102,474 T277S probably benign Het
Olfr357 T C 2: 36,996,995 F62L probably benign Het
Per2 A T 1: 91,429,382 probably null Het
Pgbd1 T C 13: 21,423,476 I183V probably benign Het
Pik3c2g T C 6: 139,730,469 V113A probably benign Het
Pipox A G 11: 77,882,648 L259P probably damaging Het
Pkd1l3 C T 8: 109,638,387 Q1124* probably null Het
Plcd3 A G 11: 103,074,931 S492P possibly damaging Het
Rcor2 T G 19: 7,271,046 M142R probably benign Het
Rwdd3 T C 3: 121,156,452 E115G probably damaging Het
Slc13a3 T C 2: 165,408,898 Y475C probably damaging Het
Slc14a2 A T 18: 78,159,082 I611N possibly damaging Het
Slc25a24 G T 3: 109,136,301 M91I probably damaging Het
Spg11 T C 2: 122,092,305 S888G probably benign Het
Spta1 A T 1: 174,187,148 probably null Het
Stk35 C A 2: 129,810,687 D369E possibly damaging Het
Tanc1 T C 2: 59,807,642 S889P probably damaging Het
Tbc1d10b T C 7: 127,198,878 N697S probably damaging Het
Tcof1 A T 18: 60,814,780 probably null Het
Tg T A 15: 66,671,311 Y25N probably damaging Het
Thbs1 T C 2: 118,119,117 C563R probably damaging Het
Tlr11 A G 14: 50,363,055 S833G possibly damaging Het
Uggt2 T A 14: 119,057,564 H550L probably benign Het
Utp20 A G 10: 88,755,186 probably null Het
Wbp1l T A 19: 46,654,319 L253Q probably damaging Het
Zfp433 T A 10: 81,720,244 S161R possibly damaging Het
Zfp865 A G 7: 5,029,783 T256A probably damaging Het
Zpr1 A G 9: 46,274,711 D160G probably benign Het
Other mutations in Olfr788
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Olfr788 APN 10 129473211 missense probably damaging 1.00
IGL02393:Olfr788 APN 10 129473195 missense probably damaging 1.00
IGL03010:Olfr788 APN 10 129472974 missense probably damaging 1.00
IGL03325:Olfr788 APN 10 129473605 missense probably benign 0.02
R1298:Olfr788 UTSW 10 129473064 missense probably damaging 1.00
R2215:Olfr788 UTSW 10 129473420 missense probably damaging 0.99
R5482:Olfr788 UTSW 10 129473078 missense probably benign 0.31
R5699:Olfr788 UTSW 10 129472877 missense probably damaging 1.00
R5794:Olfr788 UTSW 10 129473426 missense possibly damaging 0.95
R6436:Olfr788 UTSW 10 129472904 missense probably damaging 0.98
R6884:Olfr788 UTSW 10 129473154 missense probably damaging 1.00
R7908:Olfr788 UTSW 10 129472998 missense probably damaging 1.00
R8056:Olfr788 UTSW 10 129473192 missense probably benign 0.07
R8207:Olfr788 UTSW 10 129473084 missense probably benign 0.09
Z1176:Olfr788 UTSW 10 129473615 missense probably benign 0.04
Z1177:Olfr788 UTSW 10 129473064 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCACTAAATAAGCTGCACTC -3'
(R):5'- CTTCCAAGAAAGCAAAATTCCGGAG -3'

Sequencing Primer
(F):5'- CCACTAAATAAGCTGCACTCATAAAC -3'
(R):5'- CGGAGGAAGAAATACATTGGTGTTTG -3'
Posted On2018-05-21