Mutagenetix > Incidental Mutations

Incidental Mutation 'R6481:Pag1'

517078

Institutional Source

Beutler Lab

Gene Symbol

Pag1

Ensembl Gene

ENSMUSG00000027508

Gene Name

phosphoprotein associated with glycosphingolipid microdomains 1

Synonyms

F730007C19Rik, Cbp

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6481 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

9687479-9833679 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 9699336 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 252 (E252D)

Ref Sequence

ENSEMBL: ENSMUSP00000124529 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000108384] [ENSMUST00000161949]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108384
AA Change: E252D

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000104021
Gene: ENSMUSG00000027508
AA Change: E252D

Domain	Start	End	E-Value	Type
Pfam:PAG	1	429	8.7e-209	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159825

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161949
AA Change: E252D

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000124529
Gene: ENSMUSG00000027508
AA Change: E252D

Domain	Start	End	E-Value	Type
Pfam:PAG	2	429	1.4e-208	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

100% (82/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type III transmembrane adaptor protein that binds to the tyrosine kinase csk protein. It is thought to be involved in the regulation of T cell activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and exhibit no apparent defects in embryogenesis, thymic development, or T-cell functions. Mice homozygous for a different knock-out allele show normal T-cell development albeit with an increased thymocyte population. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931428L18Rik	T	C	1: 31,222,507		probably benign	Het
5430419D17Rik	A	T	7: 131,256,801	D1066V	probably benign	Het
6430573F11Rik	T	C	8: 36,498,483		probably null	Het
Abca9	G	A	11: 110,165,962	Q11*	probably null	Het
Abcc9	A	T	6: 142,604,895	M1273K	probably damaging	Het
Abi2	A	G	1: 60,438,939		probably null	Het
Acsm5	A	G	7: 119,534,881	E295G	probably benign	Het
Anapc5	T	C	5: 122,800,544	D389G	probably benign	Het
Ano3	A	T	2: 110,795,027	D159E	probably benign	Het
Arhgap26	T	A	18: 39,150,057	M349K	probably damaging	Het
Arhgef39	A	G	4: 43,498,580		probably null	Het
Astn1	T	C	1: 158,612,462	S867P	probably benign	Het
Atad3a	A	T	4: 155,753,641		probably null	Het
Cadm1	A	T	9: 47,788,109	D91V	probably damaging	Het
Cc2d2b	T	C	19: 40,802,395	I933T	possibly damaging	Het
Celsr3	C	G	9: 108,837,084	N1937K	possibly damaging	Het
Cic	A	C	7: 25,288,281	T558P	possibly damaging	Het
Cntln	A	G	4: 85,067,510	M933V	probably benign	Het
Coch	T	C	12: 51,598,173	F170S	probably damaging	Het
Col1a2	A	G	6: 4,538,680	Y1200C	unknown	Het
Col26a1	T	C	5: 136,744,178	M383V	probably benign	Het
Col4a4	A	T	1: 82,453,778	M1595K	unknown	Het
Crh	T	C	3: 19,694,337	E47G	probably benign	Het
Cyhr1	T	C	15: 76,658,708		probably null	Het
D930020B18Rik	T	C	10: 121,661,148		probably null	Het
Def6	G	A	17: 28,226,163	R482H	probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Dpagt1	T	C	9: 44,331,190	L241P	probably damaging	Het
E2f7	A	G	10: 110,774,681	E389G	probably damaging	Het
Eif2b1	T	C	5: 124,577,111	I53V	probably benign	Het
Fbxo4	A	G	15: 3,965,734	L376P	probably damaging	Het
Fgfr2	A	G	7: 130,185,278	S352P	possibly damaging	Het
Fkbpl	C	A	17: 34,645,414	P52Q	possibly damaging	Het
Fry	G	A	5: 150,386,014	R641H	probably damaging	Het
Fsip2	A	G	2: 82,990,086	T5388A	possibly damaging	Het
Gm12728	A	G	4: 105,794,349	K52R	probably damaging	Het
Gm8298	T	C	3: 59,861,057	Y3H	probably benign	Het
Gtf2a1l	A	G	17: 88,711,625	D379G	probably benign	Het
Gys1	A	T	7: 45,442,969	Y332F	possibly damaging	Het
Hoxa7	T	A	6: 52,216,614		probably benign	Het
Ifitm1	G	A	7: 140,969,606	V101I	probably benign	Het
Kalrn	T	A	16: 34,360,984	T95S	probably damaging	Het
Leng8	A	G	7: 4,145,413	Y728C	probably damaging	Het
Lonp2	G	T	8: 86,634,908	D238Y	possibly damaging	Het
Ltn1	A	C	16: 87,378,980	S1757A	probably damaging	Het
Man2a2	A	T	7: 80,364,071	S411T	probably damaging	Het
Mrps33	C	A	6: 39,805,370		probably null	Het
Muc16	C	T	9: 18,550,677		probably null	Het
Muc5ac	A	G	7: 141,809,071		probably benign	Het
Naip2	A	C	13: 100,162,041	S496A	probably benign	Het
Olfr1141	T	C	2: 87,753,468	N175S	probably damaging	Het
Olfr1204	A	T	2: 88,852,519	T190S	probably damaging	Het
Olfr122	T	G	17: 37,772,303	F217V	probably damaging	Het
Olfr1340	A	G	4: 118,726,733	Y162C	probably damaging	Het
Olfr50	T	A	2: 36,793,777	D180E	possibly damaging	Het
Olfr545	A	T	7: 102,494,139	V212D	probably damaging	Het
Plcd3	T	C	11: 103,077,767	Y366C	probably damaging	Het
Psg17	A	C	7: 18,814,450	S465R	probably damaging	Het
Ptpn9	G	T	9: 57,023,040	V50L	probably damaging	Het
Rab17	T	G	1: 90,958,961	S190R	probably benign	Het
Samd11	A	G	4: 156,249,078		probably null	Het
Slc17a5	A	G	9: 78,538,271	F434S	possibly damaging	Het
Slc22a15	A	G	3: 101,883,583	I202T	possibly damaging	Het
Slc8a1	G	T	17: 81,388,918	Q896K	probably benign	Het
Slc9a5	A	T	8: 105,358,393	K509*	probably null	Het
Slf2	A	C	19: 44,973,164	M1041L	probably benign	Het
Smn1	A	G	13: 100,128,500		probably null	Het
Snx9	T	C	17: 5,922,209		probably null	Het
Soat2	T	A	15: 102,162,055	L431Q	probably damaging	Het
Spam1	T	A	6: 24,796,930	N293K	probably benign	Het
Tatdn1	T	C	15: 58,923,911	T66A	possibly damaging	Het
Tmprss11g	A	T	5: 86,492,156	S205T	probably benign	Het
Tnpo3	G	T	6: 29,571,101	N431K	possibly damaging	Het
Trim39	T	C	17: 36,268,662	T31A	probably benign	Het
Tshz3	A	G	7: 36,752,339		probably null	Het
Ttll11	G	A	2: 35,902,754	T359M	probably damaging	Het
Ttn	T	G	2: 76,741,499	D26350A	probably damaging	Het
Ubr4	G	T	4: 139,431,751	V2472F	probably damaging	Het
Vsx2	C	T	12: 84,593,104	P265S	probably benign	Het
Wdr90	C	T	17: 25,845,911	G1708R	probably damaging	Het
Wnt11	A	G	7: 98,853,274	Y351C	probably damaging	Het
Xpo6	A	C	7: 126,112,885	N3K	probably damaging	Het
Zfp445	A	G	9: 122,857,566	S165P	probably benign	Het
Zfp953	A	T	13: 67,347,937	Y13*	probably null	Het

Other mutations in Pag1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01701:Pag1	APN	3	9693826	missense	probably damaging	0.97
R0331:Pag1	UTSW	3	9701970	missense	probably benign	0.13
R0561:Pag1	UTSW	3	9699421	missense	probably damaging	1.00
R1797:Pag1	UTSW	3	9693886	missense	probably benign	0.04
R2082:Pag1	UTSW	3	9699485	missense	probably damaging	0.96
R2315:Pag1	UTSW	3	9699764	missense	probably damaging	1.00
R3772:Pag1	UTSW	3	9699628	missense	probably benign	0.20
R4448:Pag1	UTSW	3	9699466	missense	probably benign	0.19
R5590:Pag1	UTSW	3	9699422	missense	probably damaging	1.00
R6157:Pag1	UTSW	3	9693836	missense	probably benign	0.00
R6776:Pag1	UTSW	3	9699788	missense	probably benign	0.29
R7450:Pag1	UTSW	3	9699539	missense	probably damaging	1.00
R7574:Pag1	UTSW	3	9693891	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAAATGCAGGCACAGCTGAC -3'
(R):5'- TGGAGGACTGTCTGTATGAAAC -3'

Sequencing Primer
(F):5'- AGGCACAGCTGACGCTAG -3'
(R):5'- TGTATGAAACAGTGAAGGAGATCAAG -3'

Posted On

2018-05-21