Incidental Mutation 'R6481:Wdr90'
ID517136
Institutional Source Beutler Lab
Gene Symbol Wdr90
Ensembl Gene ENSMUSG00000073434
Gene NameWD repeat domain 90
Synonyms3230401M21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R6481 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location25844771-25861501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25845911 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 1708 (G1708R)
Ref Sequence ENSEMBL: ENSMUSP00000135420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043897] [ENSMUST00000079461] [ENSMUST00000176709] [ENSMUST00000176923]
Predicted Effect probably benign
Transcript: ENSMUST00000043897
SMART Domains Protein: ENSMUSP00000044639
Gene: ENSMUSG00000025733

DomainStartEndE-ValueType
Pfam:Roc 6 122 4.1e-11 PFAM
Pfam:Ras 6 168 2.3e-18 PFAM
EFh 188 216 1.27e1 SMART
Pfam:EF_assoc_2 219 305 2.2e-35 PFAM
EFh 308 336 1.23e-1 SMART
Pfam:EF_assoc_1 341 412 1.8e-25 PFAM
Blast:AAA 416 547 7e-18 BLAST
SCOP:d1mh1__ 422 532 4e-8 SMART
transmembrane domain 595 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079461
AA Change: G1726R

PolyPhen 2 Score 0.419 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078426
Gene: ENSMUSG00000073434
AA Change: G1726R

DomainStartEndE-ValueType
low complexity region 32 53 N/A INTRINSIC
Pfam:DUF667 60 183 5e-26 PFAM
Pfam:DUF667 210 271 3.7e-9 PFAM
low complexity region 381 396 N/A INTRINSIC
WD40 478 519 5.94e0 SMART
WD40 522 565 3.2e0 SMART
WD40 572 612 3.3e1 SMART
WD40 687 725 1.15e1 SMART
WD40 728 766 5.75e-1 SMART
WD40 768 808 9.24e-4 SMART
WD40 811 850 4.13e0 SMART
WD40 853 892 4.62e-1 SMART
WD40 950 993 1.07e1 SMART
WD40 996 1035 5.75e-1 SMART
WD40 1040 1077 1.58e-2 SMART
WD40 1290 1334 5.23e-3 SMART
WD40 1337 1378 1.27e-1 SMART
WD40 1384 1419 1.83e2 SMART
WD40 1422 1469 3.08e0 SMART
WD40 1472 1509 9.9e0 SMART
WD40 1568 1607 9.02e-7 SMART
WD40 1610 1655 5.75e-1 SMART
WD40 1659 1697 2.98e-1 SMART
WD40 1700 1749 6.14e1 SMART
WD40 1850 1888 1.92e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176583
Predicted Effect probably benign
Transcript: ENSMUST00000176591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176604
Predicted Effect probably benign
Transcript: ENSMUST00000176709
SMART Domains Protein: ENSMUSP00000135436
Gene: ENSMUSG00000025733

DomainStartEndE-ValueType
Pfam:Arf 1 121 1.6e-6 PFAM
Pfam:MMR_HSR1 6 118 1.4e-6 PFAM
Pfam:Miro 6 120 7.8e-20 PFAM
Pfam:Ras 6 121 7.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176882
Predicted Effect probably damaging
Transcript: ENSMUST00000176923
AA Change: G1708R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135420
Gene: ENSMUSG00000073434
AA Change: G1708R

DomainStartEndE-ValueType
low complexity region 32 53 N/A INTRINSIC
Pfam:DUF667 60 252 5.1e-14 PFAM
low complexity region 363 378 N/A INTRINSIC
WD40 460 501 5.94e0 SMART
WD40 504 547 3.2e0 SMART
WD40 554 594 3.3e1 SMART
WD40 669 707 1.15e1 SMART
WD40 710 748 5.75e-1 SMART
WD40 750 790 9.24e-4 SMART
WD40 793 832 4.13e0 SMART
WD40 835 874 4.62e-1 SMART
WD40 932 975 1.07e1 SMART
WD40 978 1017 5.75e-1 SMART
WD40 1022 1059 1.58e-2 SMART
WD40 1272 1316 5.23e-3 SMART
WD40 1319 1360 1.27e-1 SMART
WD40 1366 1401 1.83e2 SMART
WD40 1404 1451 3.08e0 SMART
WD40 1454 1491 9.9e0 SMART
WD40 1550 1589 9.02e-7 SMART
WD40 1592 1637 5.75e-1 SMART
WD40 1641 1679 2.98e-1 SMART
WD40 1682 1731 6.14e1 SMART
WD40 1832 1870 1.92e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177122
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180868
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (82/82)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428L18Rik T C 1: 31,222,507 probably benign Het
5430419D17Rik A T 7: 131,256,801 D1066V probably benign Het
6430573F11Rik T C 8: 36,498,483 probably null Het
Abca9 G A 11: 110,165,962 Q11* probably null Het
Abcc9 A T 6: 142,604,895 M1273K probably damaging Het
Abi2 A G 1: 60,438,939 probably null Het
Acsm5 A G 7: 119,534,881 E295G probably benign Het
Anapc5 T C 5: 122,800,544 D389G probably benign Het
Ano3 A T 2: 110,795,027 D159E probably benign Het
Arhgap26 T A 18: 39,150,057 M349K probably damaging Het
Arhgef39 A G 4: 43,498,580 probably null Het
Astn1 T C 1: 158,612,462 S867P probably benign Het
Atad3a A T 4: 155,753,641 probably null Het
Cadm1 A T 9: 47,788,109 D91V probably damaging Het
Cc2d2b T C 19: 40,802,395 I933T possibly damaging Het
Celsr3 C G 9: 108,837,084 N1937K possibly damaging Het
Cic A C 7: 25,288,281 T558P possibly damaging Het
Cntln A G 4: 85,067,510 M933V probably benign Het
Coch T C 12: 51,598,173 F170S probably damaging Het
Col1a2 A G 6: 4,538,680 Y1200C unknown Het
Col26a1 T C 5: 136,744,178 M383V probably benign Het
Col4a4 A T 1: 82,453,778 M1595K unknown Het
Crh T C 3: 19,694,337 E47G probably benign Het
Cyhr1 T C 15: 76,658,708 probably null Het
D930020B18Rik T C 10: 121,661,148 probably null Het
Def6 G A 17: 28,226,163 R482H probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dpagt1 T C 9: 44,331,190 L241P probably damaging Het
E2f7 A G 10: 110,774,681 E389G probably damaging Het
Eif2b1 T C 5: 124,577,111 I53V probably benign Het
Fbxo4 A G 15: 3,965,734 L376P probably damaging Het
Fgfr2 A G 7: 130,185,278 S352P possibly damaging Het
Fkbpl C A 17: 34,645,414 P52Q possibly damaging Het
Fry G A 5: 150,386,014 R641H probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm12728 A G 4: 105,794,349 K52R probably damaging Het
Gm8298 T C 3: 59,861,057 Y3H probably benign Het
Gtf2a1l A G 17: 88,711,625 D379G probably benign Het
Gys1 A T 7: 45,442,969 Y332F possibly damaging Het
Hoxa7 T A 6: 52,216,614 probably benign Het
Ifitm1 G A 7: 140,969,606 V101I probably benign Het
Kalrn T A 16: 34,360,984 T95S probably damaging Het
Leng8 A G 7: 4,145,413 Y728C probably damaging Het
Lonp2 G T 8: 86,634,908 D238Y possibly damaging Het
Ltn1 A C 16: 87,378,980 S1757A probably damaging Het
Man2a2 A T 7: 80,364,071 S411T probably damaging Het
Mrps33 C A 6: 39,805,370 probably null Het
Muc16 C T 9: 18,550,677 probably null Het
Muc5ac A G 7: 141,809,071 probably benign Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Olfr1141 T C 2: 87,753,468 N175S probably damaging Het
Olfr1204 A T 2: 88,852,519 T190S probably damaging Het
Olfr122 T G 17: 37,772,303 F217V probably damaging Het
Olfr1340 A G 4: 118,726,733 Y162C probably damaging Het
Olfr50 T A 2: 36,793,777 D180E possibly damaging Het
Olfr545 A T 7: 102,494,139 V212D probably damaging Het
Pag1 T A 3: 9,699,336 E252D possibly damaging Het
Plcd3 T C 11: 103,077,767 Y366C probably damaging Het
Psg17 A C 7: 18,814,450 S465R probably damaging Het
Ptpn9 G T 9: 57,023,040 V50L probably damaging Het
Rab17 T G 1: 90,958,961 S190R probably benign Het
Samd11 A G 4: 156,249,078 probably null Het
Slc17a5 A G 9: 78,538,271 F434S possibly damaging Het
Slc22a15 A G 3: 101,883,583 I202T possibly damaging Het
Slc8a1 G T 17: 81,388,918 Q896K probably benign Het
Slc9a5 A T 8: 105,358,393 K509* probably null Het
Slf2 A C 19: 44,973,164 M1041L probably benign Het
Smn1 A G 13: 100,128,500 probably null Het
Snx9 T C 17: 5,922,209 probably null Het
Soat2 T A 15: 102,162,055 L431Q probably damaging Het
Spam1 T A 6: 24,796,930 N293K probably benign Het
Tatdn1 T C 15: 58,923,911 T66A possibly damaging Het
Tmprss11g A T 5: 86,492,156 S205T probably benign Het
Tnpo3 G T 6: 29,571,101 N431K possibly damaging Het
Trim39 T C 17: 36,268,662 T31A probably benign Het
Tshz3 A G 7: 36,752,339 probably null Het
Ttll11 G A 2: 35,902,754 T359M probably damaging Het
Ttn T G 2: 76,741,499 D26350A probably damaging Het
Ubr4 G T 4: 139,431,751 V2472F probably damaging Het
Vsx2 C T 12: 84,593,104 P265S probably benign Het
Wnt11 A G 7: 98,853,274 Y351C probably damaging Het
Xpo6 A C 7: 126,112,885 N3K probably damaging Het
Zfp445 A G 9: 122,857,566 S165P probably benign Het
Zfp953 A T 13: 67,347,937 Y13* probably null Het
Other mutations in Wdr90
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Wdr90 APN 17 25849364 missense probably damaging 1.00
IGL01118:Wdr90 APN 17 25854687 missense probably damaging 1.00
IGL01964:Wdr90 APN 17 25848409 missense probably benign
IGL02116:Wdr90 APN 17 25859492 missense probably benign 0.12
IGL02172:Wdr90 APN 17 25850434 missense probably benign 0.22
IGL02716:Wdr90 APN 17 25857220 missense probably damaging 0.96
IGL02961:Wdr90 APN 17 25848675 nonsense probably null
IGL03229:Wdr90 APN 17 25845463 splice site probably benign
IGL03367:Wdr90 APN 17 25847791 splice site probably benign
IGL03098:Wdr90 UTSW 17 25859987 intron probably benign
R0111:Wdr90 UTSW 17 25848444 splice site probably benign
R0454:Wdr90 UTSW 17 25860049 missense probably damaging 0.96
R0457:Wdr90 UTSW 17 25860485 missense probably benign 0.00
R0488:Wdr90 UTSW 17 25848617 missense probably damaging 1.00
R0622:Wdr90 UTSW 17 25855658 missense probably damaging 1.00
R0671:Wdr90 UTSW 17 25846393 missense probably benign 0.04
R0799:Wdr90 UTSW 17 25860130 missense probably benign 0.38
R1177:Wdr90 UTSW 17 25846054 missense possibly damaging 0.85
R1460:Wdr90 UTSW 17 25860448 missense possibly damaging 0.82
R1468:Wdr90 UTSW 17 25854053 missense probably damaging 1.00
R1468:Wdr90 UTSW 17 25854053 missense probably damaging 1.00
R1544:Wdr90 UTSW 17 25849310 missense possibly damaging 0.69
R2057:Wdr90 UTSW 17 25855199 missense probably benign 0.05
R2087:Wdr90 UTSW 17 25846603 missense probably damaging 1.00
R2159:Wdr90 UTSW 17 25851741 missense probably benign
R2208:Wdr90 UTSW 17 25860388 missense probably damaging 1.00
R2345:Wdr90 UTSW 17 25859162 missense probably benign 0.05
R2391:Wdr90 UTSW 17 25851455 missense probably damaging 1.00
R2394:Wdr90 UTSW 17 25851455 missense probably damaging 1.00
R2520:Wdr90 UTSW 17 25855352 missense probably damaging 1.00
R3798:Wdr90 UTSW 17 25850498 missense probably benign 0.01
R3979:Wdr90 UTSW 17 25859278 missense probably benign 0.00
R4111:Wdr90 UTSW 17 25849368 missense possibly damaging 0.94
R4326:Wdr90 UTSW 17 25853731 missense probably benign 0.25
R4459:Wdr90 UTSW 17 25861002 missense possibly damaging 0.95
R4697:Wdr90 UTSW 17 25855363 missense probably benign 0.03
R4735:Wdr90 UTSW 17 25859450 missense probably benign
R4907:Wdr90 UTSW 17 25860650 intron probably benign
R5070:Wdr90 UTSW 17 25846333 missense probably damaging 1.00
R5230:Wdr90 UTSW 17 25855303 missense probably benign 0.01
R5268:Wdr90 UTSW 17 25850845 missense probably damaging 1.00
R5287:Wdr90 UTSW 17 25861467 utr 5 prime probably benign
R5382:Wdr90 UTSW 17 25845598 missense probably damaging 1.00
R5511:Wdr90 UTSW 17 25845021 unclassified probably benign
R5545:Wdr90 UTSW 17 25845856 missense probably damaging 1.00
R5707:Wdr90 UTSW 17 25857192 missense probably benign 0.00
R5973:Wdr90 UTSW 17 25845133 missense probably damaging 0.99
R5973:Wdr90 UTSW 17 25846407 missense probably damaging 1.00
R6385:Wdr90 UTSW 17 25848530 missense probably damaging 1.00
R7078:Wdr90 UTSW 17 25849649 missense probably damaging 1.00
R7214:Wdr90 UTSW 17 25845393 missense probably benign 0.00
R7288:Wdr90 UTSW 17 25846312 missense probably benign 0.03
R7304:Wdr90 UTSW 17 25851506 missense probably benign 0.10
R7309:Wdr90 UTSW 17 25860702 missense probably benign 0.02
R7391:Wdr90 UTSW 17 25846528 missense probably benign 0.08
R7622:Wdr90 UTSW 17 25854109 missense probably benign 0.00
R7646:Wdr90 UTSW 17 25860130 missense probably benign 0.38
R7772:Wdr90 UTSW 17 25861491 start gained probably benign
R7779:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7780:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7781:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7782:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7812:Wdr90 UTSW 17 25852558 missense probably damaging 1.00
X0064:Wdr90 UTSW 17 25848563 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTTGTGCAGACTCCAATC -3'
(R):5'- AGGTCAGACCATCCTATCTGG -3'

Sequencing Primer
(F):5'- TTGTGCAGACTCCAATCCCCAC -3'
(R):5'- ACGGACTTGTGGCTATAAGC -3'
Posted On2018-05-21