Mutagenetix > Incidental Mutations

Incidental Mutation 'R6482:Chit1'

517148

Institutional Source

Beutler Lab

Gene Symbol

Chit1

Ensembl Gene

ENSMUSG00000026450

Gene Name

chitinase 1 (chitotriosidase)

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.184) question?

Stock #

R6482 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

134111242-134151540 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 134143242 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 20 (S20P)

Ref Sequence

ENSEMBL: ENSMUSP00000124331 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086475] [ENSMUST00000159963] [ENSMUST00000160060]

Predicted Effect

probably damaging
Transcript: ENSMUST00000086475
AA Change: S20P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000083666
Gene: ENSMUSG00000026450
AA Change: S20P

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Glyco_18	22	361	6.69e-151	SMART
ChtBD2	416	464	5.56e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000159963
AA Change: S20P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000123979
Gene: ENSMUSG00000026450
AA Change: S20P

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Glyco_18	22	361	6.69e-151	SMART
ChtBD2	416	464	5.56e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000160060
AA Change: S20P

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000124331
Gene: ENSMUSG00000026450
AA Change: S20P

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Glyco_18	22	354	2.47e-131	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.6%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chitotriosidase is secreted by activated human macrophages and is markedly elevated in plasma of Gaucher disease patients. The expression of chitotriosidase occurs only at a late stage of differentiation of monocytes to activated macrophages in culture. Human macrophages can synthesize a functional chitotriosidase, a highly conserved enzyme with a strongly regulated expression. This enzyme may play a role in the degradation of chitin-containing pathogens. Several alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced pulmonary fibrosis induced by bleomycin or IL13 expression. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadvl	T	C	11: 70,011,562	I415V	probably benign	Het
Akap8l	A	G	17: 32,345,396	F6L	possibly damaging	Het
Ano3	T	A	2: 110,697,055	N603Y	probably damaging	Het
Casp8ap2	T	C	4: 32,634,813	S116P	probably damaging	Het
Ccdc110	A	T	8: 45,942,788	Q572L	probably benign	Het
Col22a1	G	A	15: 71,890,489	P107L	possibly damaging	Het
Dpys	T	C	15: 39,841,973	H248R	probably damaging	Het
Dsg2	A	T	18: 20,601,314	K783I	possibly damaging	Het
Efnb2	A	T	8: 8,620,637	V321E	probably damaging	Het
Fbxo11	A	T	17: 88,012,658	Y209N	probably benign	Het
Gm21936	A	G	12: 87,795,795	Y95C	probably damaging	Het
Gm35315	A	T	5: 110,078,089	C495S	possibly damaging	Het
Hrh1	A	G	6: 114,480,763	Q335R	possibly damaging	Het
Il12rb2	A	G	6: 67,356,686	L203P	probably damaging	Het
Itgav	T	C	2: 83,794,270	S735P	probably damaging	Het
Klrg1	G	T	6: 122,271,453	C162*	probably null	Het
Mcc	T	C	18: 44,445,864	S651G	possibly damaging	Het
Nkx2-2	T	A	2: 147,185,976	I15F	probably damaging	Het
Nppa	G	A	4: 148,000,871	V13I	probably benign	Het
Olfr1104	G	C	2: 87,022,525	F6L	probably benign	Het
Pde2a	A	G	7: 101,501,037	N228D	probably benign	Het
Pgpep1l	C	T	7: 68,239,067		probably null	Het
Plekhg3	A	G	12: 76,576,004	N673D	probably benign	Het
Plxna4	A	G	6: 32,516,737	S315P	probably benign	Het
Psg21	A	T	7: 18,654,739		probably null	Het
Rnf111	T	C	9: 70,429,607	T925A	probably damaging	Het
Rnf219	A	T	14: 104,479,817	C373*	probably null	Het
Spag9	T	C	11: 94,093,502	F734L	possibly damaging	Het
Tarbp1	A	G	8: 126,450,695	V746A	probably benign	Het
Tmtc1	A	G	6: 148,412,745	F119L	probably benign	Het
Ttc21b	A	G	2: 66,226,900	M576T	probably benign	Het
Usp48	T	A	4: 137,634,921	V765E	probably damaging	Het
Vmn1r20	A	G	6: 57,432,108	S140G	probably benign	Het
Vwde	A	G	6: 13,205,844	S235P	probably damaging	Het
Wapl	A	G	14: 34,692,692	S504G	probably benign	Het
Wnt5b	A	T	6: 119,433,612	L289Q	possibly damaging	Het
Zfp142	G	A	1: 74,570,217		probably null	Het
Zfp385b	ATCTTCTTCTTCT	ATCTTCTTCTTCTTCT	2: 77,719,648		probably benign	Het
Zfp948	A	G	17: 21,587,551	H335R	probably benign	Het

Other mutations in Chit1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00927:Chit1	APN	1	134145254	missense	probably damaging	1.00
IGL01344:Chit1	APN	1	134151314	missense	probably damaging	1.00
IGL01352:Chit1	APN	1	134148490	missense	probably damaging	1.00
IGL01620:Chit1	APN	1	134150519	missense	probably damaging	1.00
IGL01795:Chit1	APN	1	134148429	missense	probably damaging	1.00
IGL01924:Chit1	APN	1	134149410	missense	probably benign	0.05
IGL02000:Chit1	APN	1	134146675	missense	probably benign	0.01
IGL02891:Chit1	APN	1	134145310	missense	probably benign	0.38
Debt	UTSW	1	134149425	missense	probably null	1.00
R0790:Chit1	UTSW	1	134138752	missense	probably benign	0.00
R0838:Chit1	UTSW	1	134143337	nonsense	probably null
R1783:Chit1	UTSW	1	134149394	missense	possibly damaging	0.67
R1783:Chit1	UTSW	1	134149395	missense	probably benign	0.03
R1784:Chit1	UTSW	1	134149394	missense	possibly damaging	0.67
R1863:Chit1	UTSW	1	134151250	missense	probably damaging	0.96
R1940:Chit1	UTSW	1	134145418	critical splice donor site	probably null
R1950:Chit1	UTSW	1	134151230	missense	probably damaging	1.00
R2045:Chit1	UTSW	1	134151144	missense	probably benign	0.05
R2260:Chit1	UTSW	1	134151127	missense	probably benign
R4552:Chit1	UTSW	1	134144051	missense	probably benign	0.17
R5386:Chit1	UTSW	1	134149454	missense	probably damaging	1.00
R5975:Chit1	UTSW	1	134146626	missense	probably damaging	1.00
R6134:Chit1	UTSW	1	134144060	missense	possibly damaging	0.94
R6196:Chit1	UTSW	1	134146643	nonsense	probably null
R6923:Chit1	UTSW	1	134149425	missense	probably null	1.00
R6952:Chit1	UTSW	1	134143284	missense	probably damaging	1.00
R7022:Chit1	UTSW	1	134151292	missense	probably benign	0.44
R7198:Chit1	UTSW	1	134150491	missense	possibly damaging	0.87
R8079:Chit1	UTSW	1	134144027	missense	possibly damaging	0.79

Predicted Primers

PCR Primer
(F):5'- ATGAGGGTTCCAGCACTGAC -3'
(R):5'- AGAAGTTCGTCATTGTGCTCC -3'

Sequencing Primer
(F):5'- GCCCCCGTGACTAACCTATG -3'
(R):5'- CATTGTGCTCCACAGTGCTGAG -3'

Posted On

2018-05-21