Incidental Mutation 'R6482:Zfp385b'
ID 517150
Institutional Source Beutler Lab
Gene Symbol Zfp385b
Ensembl Gene ENSMUSG00000027016
Gene Name zinc finger protein 385B
Synonyms C130013B13Rik, Zfp533, B830010L13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6482 (G1)
Quality Score 217.468
Status Validated
Chromosome 2
Chromosomal Location 77410634-77819639 bp(-) (GRCm38)
Type of Mutation small insertion (1 aa in frame mutation)
DNA Base Change (assembly) ATCTTCTTCTTCT to ATCTTCTTCTTCTTCT at 77719648 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090766] [ENSMUST00000111829] [ENSMUST00000111831]
AlphaFold Q8BXJ8
Predicted Effect probably benign
Transcript: ENSMUST00000090766
SMART Domains Protein: ENSMUSP00000088271
Gene: ENSMUSG00000027016

DomainStartEndE-ValueType
ZnF_U1 30 65 3.07e-4 SMART
ZnF_C2H2 34 58 3.21e1 SMART
low complexity region 66 81 N/A INTRINSIC
low complexity region 83 92 N/A INTRINSIC
ZnF_U1 166 200 9.3e-4 SMART
ZnF_C2H2 169 193 5.07e0 SMART
low complexity region 245 256 N/A INTRINSIC
ZnF_U1 294 328 2.29e-3 SMART
ZnF_C2H2 297 321 1.47e1 SMART
ZnF_U1 357 391 8.09e-4 SMART
ZnF_C2H2 360 384 6.57e-1 SMART
low complexity region 429 452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111829
SMART Domains Protein: ENSMUSP00000107460
Gene: ENSMUSG00000027016

DomainStartEndE-ValueType
Pfam:zf-met 33 58 3.2e-9 PFAM
Pfam:zf-C2H2_jaz 34 59 9.1e-8 PFAM
low complexity region 66 81 N/A INTRINSIC
low complexity region 83 92 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111831
SMART Domains Protein: ENSMUSP00000107462
Gene: ENSMUSG00000027016

DomainStartEndE-ValueType
ZnF_U1 30 65 3.07e-4 SMART
ZnF_C2H2 34 58 3.21e1 SMART
low complexity region 66 81 N/A INTRINSIC
low complexity region 83 92 N/A INTRINSIC
ZnF_U1 166 200 9.3e-4 SMART
ZnF_C2H2 169 193 5.07e0 SMART
low complexity region 245 256 N/A INTRINSIC
ZnF_U1 294 328 2.29e-3 SMART
ZnF_C2H2 297 321 1.47e1 SMART
ZnF_U1 357 391 8.09e-4 SMART
ZnF_C2H2 360 384 6.57e-1 SMART
low complexity region 429 452 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadvl T C 11: 70,011,562 I415V probably benign Het
Akap8l A G 17: 32,345,396 F6L possibly damaging Het
Ano3 T A 2: 110,697,055 N603Y probably damaging Het
Casp8ap2 T C 4: 32,634,813 S116P probably damaging Het
Ccdc110 A T 8: 45,942,788 Q572L probably benign Het
Chit1 T C 1: 134,143,242 S20P probably damaging Het
Col22a1 G A 15: 71,890,489 P107L possibly damaging Het
Dpys T C 15: 39,841,973 H248R probably damaging Het
Dsg2 A T 18: 20,601,314 K783I possibly damaging Het
Efnb2 A T 8: 8,620,637 V321E probably damaging Het
Fbxo11 A T 17: 88,012,658 Y209N probably benign Het
Gm21936 A G 12: 87,795,795 Y95C probably damaging Het
Gm35315 A T 5: 110,078,089 C495S possibly damaging Het
Hrh1 A G 6: 114,480,763 Q335R possibly damaging Het
Il12rb2 A G 6: 67,356,686 L203P probably damaging Het
Itgav T C 2: 83,794,270 S735P probably damaging Het
Klrg1 G T 6: 122,271,453 C162* probably null Het
Mcc T C 18: 44,445,864 S651G possibly damaging Het
Nkx2-2 T A 2: 147,185,976 I15F probably damaging Het
Nppa G A 4: 148,000,871 V13I probably benign Het
Olfr1104 G C 2: 87,022,525 F6L probably benign Het
Pde2a A G 7: 101,501,037 N228D probably benign Het
Pgpep1l C T 7: 68,239,067 probably null Het
Plekhg3 A G 12: 76,576,004 N673D probably benign Het
Plxna4 A G 6: 32,516,737 S315P probably benign Het
Psg21 A T 7: 18,654,739 probably null Het
Rnf111 T C 9: 70,429,607 T925A probably damaging Het
Rnf219 A T 14: 104,479,817 C373* probably null Het
Spag9 T C 11: 94,093,502 F734L possibly damaging Het
Tarbp1 A G 8: 126,450,695 V746A probably benign Het
Tmtc1 A G 6: 148,412,745 F119L probably benign Het
Ttc21b A G 2: 66,226,900 M576T probably benign Het
Usp48 T A 4: 137,634,921 V765E probably damaging Het
Vmn1r20 A G 6: 57,432,108 S140G probably benign Het
Vwde A G 6: 13,205,844 S235P probably damaging Het
Wapl A G 14: 34,692,692 S504G probably benign Het
Wnt5b A T 6: 119,433,612 L289Q possibly damaging Het
Zfp142 G A 1: 74,570,217 probably null Het
Zfp948 A G 17: 21,587,551 H335R probably benign Het
Other mutations in Zfp385b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Zfp385b APN 2 77476778 missense probably damaging 1.00
IGL01684:Zfp385b APN 2 77719675 missense possibly damaging 0.86
IGL02354:Zfp385b APN 2 77450303 missense probably damaging 1.00
IGL02361:Zfp385b APN 2 77450303 missense probably damaging 1.00
IGL02939:Zfp385b APN 2 77412059 missense probably benign 0.00
R0008:Zfp385b UTSW 2 77415947 missense probably benign 0.27
R0008:Zfp385b UTSW 2 77415947 missense probably benign 0.27
R0243:Zfp385b UTSW 2 77415728 critical splice donor site probably null
R0403:Zfp385b UTSW 2 77476845 missense probably damaging 0.97
R1566:Zfp385b UTSW 2 77415913 missense probably benign 0.05
R1799:Zfp385b UTSW 2 77415972 missense probably benign 0.13
R3618:Zfp385b UTSW 2 77415889 missense probably benign
R3619:Zfp385b UTSW 2 77415889 missense probably benign
R4007:Zfp385b UTSW 2 77719492 missense probably benign 0.00
R6290:Zfp385b UTSW 2 77450268 missense possibly damaging 0.90
R6298:Zfp385b UTSW 2 77413979 missense possibly damaging 0.83
R6383:Zfp385b UTSW 2 77415841 missense probably benign 0.01
R6484:Zfp385b UTSW 2 77719648 small insertion probably benign
R6856:Zfp385b UTSW 2 77415794 missense probably damaging 1.00
R7276:Zfp385b UTSW 2 77450280 missense probably damaging 1.00
R8692:Zfp385b UTSW 2 77719627 missense probably damaging 1.00
R8982:Zfp385b UTSW 2 77411956 missense probably damaging 0.96
R9299:Zfp385b UTSW 2 77415771 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGTAACAGGACCAGTTTTCC -3'
(R):5'- TACCTGCACTGGAAGGTACG -3'

Sequencing Primer
(F):5'- GTTTTCCAAAAAGACAGTGGTGCC -3'
(R):5'- CGAGAGCACATATAAATTTATAGGCC -3'
Posted On 2018-05-21