Incidental Mutation 'R6482:Olfr1104'
ID517152
Institutional Source Beutler Lab
Gene Symbol Olfr1104
Ensembl Gene ENSMUSG00000075166
Gene Nameolfactory receptor 1104
SynonymsGA_x6K02T2Q125-48508763-48507833, MOR207-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.901) question?
Stock #R6482 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87020703-87027080 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 87022525 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 6 (F6L)
Ref Sequence ENSEMBL: ENSMUSP00000149240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099869] [ENSMUST00000214857] [ENSMUST00000215972]
Predicted Effect probably benign
Transcript: ENSMUST00000099869
AA Change: F6L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000097454
Gene: ENSMUSG00000075166
AA Change: F6L

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 9.3e-48 PFAM
Pfam:7tm_1 41 289 2.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214857
AA Change: F6L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000215972
AA Change: F6L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0748 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadvl T C 11: 70,011,562 I415V probably benign Het
Akap8l A G 17: 32,345,396 F6L possibly damaging Het
Ano3 T A 2: 110,697,055 N603Y probably damaging Het
Casp8ap2 T C 4: 32,634,813 S116P probably damaging Het
Ccdc110 A T 8: 45,942,788 Q572L probably benign Het
Chit1 T C 1: 134,143,242 S20P probably damaging Het
Col22a1 G A 15: 71,890,489 P107L possibly damaging Het
Dpys T C 15: 39,841,973 H248R probably damaging Het
Dsg2 A T 18: 20,601,314 K783I possibly damaging Het
Efnb2 A T 8: 8,620,637 V321E probably damaging Het
Fbxo11 A T 17: 88,012,658 Y209N probably benign Het
Gm21936 A G 12: 87,795,795 Y95C probably damaging Het
Gm35315 A T 5: 110,078,089 C495S possibly damaging Het
Hrh1 A G 6: 114,480,763 Q335R possibly damaging Het
Il12rb2 A G 6: 67,356,686 L203P probably damaging Het
Itgav T C 2: 83,794,270 S735P probably damaging Het
Klrg1 G T 6: 122,271,453 C162* probably null Het
Mcc T C 18: 44,445,864 S651G possibly damaging Het
Nkx2-2 T A 2: 147,185,976 I15F probably damaging Het
Nppa G A 4: 148,000,871 V13I probably benign Het
Pde2a A G 7: 101,501,037 N228D probably benign Het
Pgpep1l C T 7: 68,239,067 probably null Het
Plekhg3 A G 12: 76,576,004 N673D probably benign Het
Plxna4 A G 6: 32,516,737 S315P probably benign Het
Psg21 A T 7: 18,654,739 probably null Het
Rnf111 T C 9: 70,429,607 T925A probably damaging Het
Rnf219 A T 14: 104,479,817 C373* probably null Het
Spag9 T C 11: 94,093,502 F734L possibly damaging Het
Tarbp1 A G 8: 126,450,695 V746A probably benign Het
Tmtc1 A G 6: 148,412,745 F119L probably benign Het
Ttc21b A G 2: 66,226,900 M576T probably benign Het
Usp48 T A 4: 137,634,921 V765E probably damaging Het
Vmn1r20 A G 6: 57,432,108 S140G probably benign Het
Vwde A G 6: 13,205,844 S235P probably damaging Het
Wapl A G 14: 34,692,692 S504G probably benign Het
Wnt5b A T 6: 119,433,612 L289Q possibly damaging Het
Zfp142 G A 1: 74,570,217 probably null Het
Zfp385b ATCTTCTTCTTCT ATCTTCTTCTTCTTCT 2: 77,719,648 probably benign Het
Zfp948 A G 17: 21,587,551 H335R probably benign Het
Other mutations in Olfr1104
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Olfr1104 APN 2 87021884 missense probably damaging 1.00
IGL02533:Olfr1104 APN 2 87022353 missense probably damaging 1.00
IGL02662:Olfr1104 APN 2 87022002 missense probably benign 0.09
IGL02704:Olfr1104 APN 2 87022277 missense probably benign 0.00
R0145:Olfr1104 UTSW 2 87021790 nonsense probably null
R0625:Olfr1104 UTSW 2 87021620 missense probably benign
R1169:Olfr1104 UTSW 2 87021717 missense probably damaging 1.00
R1570:Olfr1104 UTSW 2 87022272 missense probably benign
R1727:Olfr1104 UTSW 2 87022263 missense probably damaging 1.00
R2146:Olfr1104 UTSW 2 87021665 missense probably damaging 1.00
R2192:Olfr1104 UTSW 2 87022511 missense probably benign 0.01
R3716:Olfr1104 UTSW 2 87022363 nonsense probably null
R3818:Olfr1104 UTSW 2 87021710 missense probably benign 0.02
R4711:Olfr1104 UTSW 2 87022026 missense probably damaging 1.00
R6104:Olfr1104 UTSW 2 87021713 missense probably damaging 1.00
R7474:Olfr1104 UTSW 2 87022554 start gained probably benign
R7517:Olfr1104 UTSW 2 87022142 missense probably benign 0.45
R7610:Olfr1104 UTSW 2 87021797 missense possibly damaging 0.59
R7944:Olfr1104 UTSW 2 87022313 missense probably benign 0.01
R7945:Olfr1104 UTSW 2 87022313 missense probably benign 0.01
R8235:Olfr1104 UTSW 2 87021882 missense probably benign 0.36
X0019:Olfr1104 UTSW 2 87021635 missense probably benign 0.00
Z1177:Olfr1104 UTSW 2 87021618 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTCAATGAATGCTAAATTGCTGAGG -3'
(R):5'- TGTCACAATGATAGAGTTGGGTAG -3'

Sequencing Primer
(F):5'- TGCCCCACACAGTGAATA -3'
(R):5'- CACTTCTTCAGAGGACCAGAGTTTG -3'
Posted On2018-05-21