Mutagenetix > Incidental Mutation

Incidental Mutation 'R6482:Olfr1104'

517152

Institutional Source

Beutler Lab

Gene Symbol

Olfr1104

Ensembl Gene

ENSMUSG00000075166

Gene Name

olfactory receptor 1104

Synonyms

GA_x6K02T2Q125-48508763-48507833, MOR207-1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.894) question?

Stock #

R6482 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

87020703-87027080 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 87022525 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 6 (F6L)

Ref Sequence

ENSEMBL: ENSMUSP00000149240 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099869] [ENSMUST00000214857] [ENSMUST00000215972]

AlphaFold

A2AVB5

Predicted Effect

probably benign
Transcript: ENSMUST00000099869
AA Change: F6L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000097454
Gene: ENSMUSG00000075166
AA Change: F6L

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	307	9.3e-48	PFAM
Pfam:7tm_1	41	289	2.3e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000214857
AA Change: F6L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Predicted Effect

probably benign
Transcript: ENSMUST00000215972
AA Change: F6L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Meta Mutation Damage Score

0.0748

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.6%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadvl	T	C	11: 70,011,562	I415V	probably benign	Het
Akap8l	A	G	17: 32,345,396	F6L	possibly damaging	Het
Ano3	T	A	2: 110,697,055	N603Y	probably damaging	Het
Casp8ap2	T	C	4: 32,634,813	S116P	probably damaging	Het
Ccdc110	A	T	8: 45,942,788	Q572L	probably benign	Het
Chit1	T	C	1: 134,143,242	S20P	probably damaging	Het
Col22a1	G	A	15: 71,890,489	P107L	possibly damaging	Het
Dpys	T	C	15: 39,841,973	H248R	probably damaging	Het
Dsg2	A	T	18: 20,601,314	K783I	possibly damaging	Het
Efnb2	A	T	8: 8,620,637	V321E	probably damaging	Het
Fbxo11	A	T	17: 88,012,658	Y209N	probably benign	Het
Gm21936	A	G	12: 87,795,795	Y95C	probably damaging	Het
Gm35315	A	T	5: 110,078,089	C495S	possibly damaging	Het
Hrh1	A	G	6: 114,480,763	Q335R	possibly damaging	Het
Il12rb2	A	G	6: 67,356,686	L203P	probably damaging	Het
Itgav	T	C	2: 83,794,270	S735P	probably damaging	Het
Klrg1	G	T	6: 122,271,453	C162*	probably null	Het
Mcc	T	C	18: 44,445,864	S651G	possibly damaging	Het
Nkx2-2	T	A	2: 147,185,976	I15F	probably damaging	Het
Nppa	G	A	4: 148,000,871	V13I	probably benign	Het
Pde2a	A	G	7: 101,501,037	N228D	probably benign	Het
Pgpep1l	C	T	7: 68,239,067		probably null	Het
Plekhg3	A	G	12: 76,576,004	N673D	probably benign	Het
Plxna4	A	G	6: 32,516,737	S315P	probably benign	Het
Psg21	A	T	7: 18,654,739		probably null	Het
Rnf111	T	C	9: 70,429,607	T925A	probably damaging	Het
Rnf219	A	T	14: 104,479,817	C373*	probably null	Het
Spag9	T	C	11: 94,093,502	F734L	possibly damaging	Het
Tarbp1	A	G	8: 126,450,695	V746A	probably benign	Het
Tmtc1	A	G	6: 148,412,745	F119L	probably benign	Het
Ttc21b	A	G	2: 66,226,900	M576T	probably benign	Het
Usp48	T	A	4: 137,634,921	V765E	probably damaging	Het
Vmn1r20	A	G	6: 57,432,108	S140G	probably benign	Het
Vwde	A	G	6: 13,205,844	S235P	probably damaging	Het
Wapl	A	G	14: 34,692,692	S504G	probably benign	Het
Wnt5b	A	T	6: 119,433,612	L289Q	possibly damaging	Het
Zfp142	G	A	1: 74,570,217		probably null	Het
Zfp385b	ATCTTCTTCTTCT	ATCTTCTTCTTCTTCT	2: 77,719,648		probably benign	Het
Zfp948	A	G	17: 21,587,551	H335R	probably benign	Het

Other mutations in Olfr1104

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01534:Olfr1104	APN	2	87021884	missense	probably damaging	1.00
IGL02533:Olfr1104	APN	2	87022353	missense	probably damaging	1.00
IGL02662:Olfr1104	APN	2	87022002	missense	probably benign	0.09
IGL02704:Olfr1104	APN	2	87022277	missense	probably benign	0.00
R0145:Olfr1104	UTSW	2	87021790	nonsense	probably null
R0625:Olfr1104	UTSW	2	87021620	missense	probably benign
R1169:Olfr1104	UTSW	2	87021717	missense	probably damaging	1.00
R1570:Olfr1104	UTSW	2	87022272	missense	probably benign
R1727:Olfr1104	UTSW	2	87022263	missense	probably damaging	1.00
R2146:Olfr1104	UTSW	2	87021665	missense	probably damaging	1.00
R2192:Olfr1104	UTSW	2	87022511	missense	probably benign	0.01
R3716:Olfr1104	UTSW	2	87022363	nonsense	probably null
R3818:Olfr1104	UTSW	2	87021710	missense	probably benign	0.02
R4711:Olfr1104	UTSW	2	87022026	missense	probably damaging	1.00
R6104:Olfr1104	UTSW	2	87021713	missense	probably damaging	1.00
R7474:Olfr1104	UTSW	2	87022554	start gained	probably benign
R7517:Olfr1104	UTSW	2	87022142	missense	probably benign	0.45
R7610:Olfr1104	UTSW	2	87021797	missense	possibly damaging	0.59
R7944:Olfr1104	UTSW	2	87022313	missense	probably benign	0.01
R7945:Olfr1104	UTSW	2	87022313	missense	probably benign	0.01
R8235:Olfr1104	UTSW	2	87021882	missense	probably benign	0.36
R8966:Olfr1104	UTSW	2	87022535	missense	possibly damaging	0.60
R9002:Olfr1104	UTSW	2	87021897	missense	probably benign	0.41
X0019:Olfr1104	UTSW	2	87021635	missense	probably benign	0.00
Z1177:Olfr1104	UTSW	2	87021618	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GTCAATGAATGCTAAATTGCTGAGG -3'
(R):5'- TGTCACAATGATAGAGTTGGGTAG -3'

Sequencing Primer
(F):5'- TGCCCCACACAGTGAATA -3'
(R):5'- CACTTCTTCAGAGGACCAGAGTTTG -3'

Posted On

2018-05-21