Incidental Mutation 'R6482:Nkx2-2'
ID 517154
Institutional Source Beutler Lab
Gene Symbol Nkx2-2
Ensembl Gene ENSMUSG00000027434
Gene Name NK2 homeobox 2
Synonyms Nkx2.2, tinman, Nkx-2.2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6482 (G1)
Quality Score 163.009
Status Validated
Chromosome 2
Chromosomal Location 147177546-147194243 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 147185976 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 15 (I15F)
Ref Sequence ENSEMBL: ENSMUSP00000105596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067075] [ENSMUST00000109970]
AlphaFold P42586
Predicted Effect probably damaging
Transcript: ENSMUST00000067075
AA Change: I15F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069666
Gene: ENSMUSG00000027434
AA Change: I15F

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
HOX 128 190 2.66e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109969
Predicted Effect probably damaging
Transcript: ENSMUST00000109970
AA Change: I15F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105596
Gene: ENSMUSG00000027434
AA Change: I15F

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
HOX 128 190 2.66e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136998
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144411
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172627
Meta Mutation Damage Score 0.2752 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a homeobox domain and may be involved in the morphogenesis of the central nervous system. This gene is found on chromosome 20 near NKX2-4, and these two genes appear to be duplicated on chromosome 14 in the form of TITF1 and NKX2-8. The encoded protein is likely to be a nuclear transcription factor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants die within a few days of birth with severe hyperglycemia due to arrested differentiation of pancreatic beta cells. Mutant embryos exhibit retarded oligodendrocyte differentiation and a virtual loss of serotonergic neurons at the r2 level of the hindbrain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadvl T C 11: 70,011,562 I415V probably benign Het
Akap8l A G 17: 32,345,396 F6L possibly damaging Het
Ano3 T A 2: 110,697,055 N603Y probably damaging Het
Casp8ap2 T C 4: 32,634,813 S116P probably damaging Het
Ccdc110 A T 8: 45,942,788 Q572L probably benign Het
Chit1 T C 1: 134,143,242 S20P probably damaging Het
Col22a1 G A 15: 71,890,489 P107L possibly damaging Het
Dpys T C 15: 39,841,973 H248R probably damaging Het
Dsg2 A T 18: 20,601,314 K783I possibly damaging Het
Efnb2 A T 8: 8,620,637 V321E probably damaging Het
Fbxo11 A T 17: 88,012,658 Y209N probably benign Het
Gm21936 A G 12: 87,795,795 Y95C probably damaging Het
Gm35315 A T 5: 110,078,089 C495S possibly damaging Het
Hrh1 A G 6: 114,480,763 Q335R possibly damaging Het
Il12rb2 A G 6: 67,356,686 L203P probably damaging Het
Itgav T C 2: 83,794,270 S735P probably damaging Het
Klrg1 G T 6: 122,271,453 C162* probably null Het
Mcc T C 18: 44,445,864 S651G possibly damaging Het
Nppa G A 4: 148,000,871 V13I probably benign Het
Olfr1104 G C 2: 87,022,525 F6L probably benign Het
Pde2a A G 7: 101,501,037 N228D probably benign Het
Pgpep1l C T 7: 68,239,067 probably null Het
Plekhg3 A G 12: 76,576,004 N673D probably benign Het
Plxna4 A G 6: 32,516,737 S315P probably benign Het
Psg21 A T 7: 18,654,739 probably null Het
Rnf111 T C 9: 70,429,607 T925A probably damaging Het
Rnf219 A T 14: 104,479,817 C373* probably null Het
Spag9 T C 11: 94,093,502 F734L possibly damaging Het
Tarbp1 A G 8: 126,450,695 V746A probably benign Het
Tmtc1 A G 6: 148,412,745 F119L probably benign Het
Ttc21b A G 2: 66,226,900 M576T probably benign Het
Usp48 T A 4: 137,634,921 V765E probably damaging Het
Vmn1r20 A G 6: 57,432,108 S140G probably benign Het
Vwde A G 6: 13,205,844 S235P probably damaging Het
Wapl A G 14: 34,692,692 S504G probably benign Het
Wnt5b A T 6: 119,433,612 L289Q possibly damaging Het
Zfp142 G A 1: 74,570,217 probably null Het
Zfp385b ATCTTCTTCTTCT ATCTTCTTCTTCTTCT 2: 77,719,648 probably benign Het
Zfp948 A G 17: 21,587,551 H335R probably benign Het
Other mutations in Nkx2-2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01660:Nkx2-2 APN 2 147185913 missense probably benign 0.03
IGL03026:Nkx2-2 APN 2 147185822 missense probably damaging 0.96
R0212:Nkx2-2 UTSW 2 147184170 missense probably damaging 0.99
R4024:Nkx2-2 UTSW 2 147184234 missense probably benign 0.07
R4821:Nkx2-2 UTSW 2 147185843 missense possibly damaging 0.81
R5645:Nkx2-2 UTSW 2 147184399 missense probably damaging 1.00
R6024:Nkx2-2 UTSW 2 147184041 missense probably benign 0.00
R7852:Nkx2-2 UTSW 2 147184269 missense probably damaging 1.00
R7859:Nkx2-2 UTSW 2 147177810 missense unknown
R8792:Nkx2-2 UTSW 2 147177893 missense probably benign 0.22
R9633:Nkx2-2 UTSW 2 147185766 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CGCTACTTACGGGAGTATTGG -3'
(R):5'- TGCGTGCTTTCCGAGAAGAG -3'

Sequencing Primer
(F):5'- CTACTTACGGGAGTATTGGAGGCC -3'
(R):5'- CTTTCCGAGAAGAGAGAGGCACC -3'
Posted On 2018-05-21