Incidental Mutation 'R6482:Gm35315'
ID 517158
Institutional Source Beutler Lab
Gene Symbol Gm35315
Ensembl Gene ENSMUSG00000109771
Gene Name predicted gene, 35315
Synonyms Gm20090
MMRRC Submission 044614-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R6482 (G1)
Quality Score 194.009
Status Validated
Chromosome 5
Chromosomal Location 110224001-110241292 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 110225955 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 495 (C495S)
Ref Sequence ENSEMBL: ENSMUSP00000147534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000210052] [ENSMUST00000211397]
AlphaFold A0A1B0GRI2
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209865
Predicted Effect possibly damaging
Transcript: ENSMUST00000210052
AA Change: C495S

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000211397
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadvl T C 11: 69,902,388 (GRCm39) I415V probably benign Het
Akap8l A G 17: 32,564,370 (GRCm39) F6L possibly damaging Het
Ano3 T A 2: 110,527,400 (GRCm39) N603Y probably damaging Het
Casp8ap2 T C 4: 32,634,813 (GRCm39) S116P probably damaging Het
Ccdc110 A T 8: 46,395,825 (GRCm39) Q572L probably benign Het
Chit1 T C 1: 134,070,980 (GRCm39) S20P probably damaging Het
Col22a1 G A 15: 71,762,338 (GRCm39) P107L possibly damaging Het
Dpys T C 15: 39,705,369 (GRCm39) H248R probably damaging Het
Dsg2 A T 18: 20,734,371 (GRCm39) K783I possibly damaging Het
Efnb2 A T 8: 8,670,637 (GRCm39) V321E probably damaging Het
Eif1ad13 A G 12: 87,762,565 (GRCm39) Y95C probably damaging Het
Fbxo11 A T 17: 88,320,086 (GRCm39) Y209N probably benign Het
Hrh1 A G 6: 114,457,724 (GRCm39) Q335R possibly damaging Het
Il12rb2 A G 6: 67,333,670 (GRCm39) L203P probably damaging Het
Itgav T C 2: 83,624,614 (GRCm39) S735P probably damaging Het
Klrg1 G T 6: 122,248,412 (GRCm39) C162* probably null Het
Mcc T C 18: 44,578,931 (GRCm39) S651G possibly damaging Het
Nkx2-2 T A 2: 147,027,896 (GRCm39) I15F probably damaging Het
Nppa G A 4: 148,085,328 (GRCm39) V13I probably benign Het
Obi1 A T 14: 104,717,253 (GRCm39) C373* probably null Het
Or8i2 G C 2: 86,852,869 (GRCm39) F6L probably benign Het
Pde2a A G 7: 101,150,244 (GRCm39) N228D probably benign Het
Pgpep1l C T 7: 67,888,815 (GRCm39) probably null Het
Plekhg3 A G 12: 76,622,778 (GRCm39) N673D probably benign Het
Plxna4 A G 6: 32,493,672 (GRCm39) S315P probably benign Het
Psg21 A T 7: 18,388,664 (GRCm39) probably null Het
Rnf111 T C 9: 70,336,889 (GRCm39) T925A probably damaging Het
Spag9 T C 11: 93,984,328 (GRCm39) F734L possibly damaging Het
Tarbp1 A G 8: 127,177,434 (GRCm39) V746A probably benign Het
Tmtc1 A G 6: 148,314,243 (GRCm39) F119L probably benign Het
Ttc21b A G 2: 66,057,244 (GRCm39) M576T probably benign Het
Usp48 T A 4: 137,362,232 (GRCm39) V765E probably damaging Het
Vmn1r20 A G 6: 57,409,093 (GRCm39) S140G probably benign Het
Vwde A G 6: 13,205,843 (GRCm39) S235P probably damaging Het
Wapl A G 14: 34,414,649 (GRCm39) S504G probably benign Het
Wnt5b A T 6: 119,410,573 (GRCm39) L289Q possibly damaging Het
Zfp142 G A 1: 74,609,376 (GRCm39) probably null Het
Zfp385b ATCTTCTTCTTCT ATCTTCTTCTTCTTCT 2: 77,549,992 (GRCm39) probably benign Het
Zfp948 A G 17: 21,807,813 (GRCm39) H335R probably benign Het
Other mutations in Gm35315
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6103:Gm35315 UTSW 5 110,226,137 (GRCm39) missense probably damaging 0.97
R6219:Gm35315 UTSW 5 110,226,410 (GRCm39) missense probably benign 0.23
R6429:Gm35315 UTSW 5 110,226,525 (GRCm39) missense possibly damaging 0.67
R6436:Gm35315 UTSW 5 110,226,578 (GRCm39) missense probably benign
R6632:Gm35315 UTSW 5 110,227,129 (GRCm39) nonsense probably null
R7313:Gm35315 UTSW 5 110,227,091 (GRCm39) missense probably benign
R8699:Gm35315 UTSW 5 110,228,392 (GRCm39) missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CTGGGTGGAGCTTAAGCACA -3'
(R):5'- ACCAGAGAGAAACCCTATGAATGTG -3'

Sequencing Primer
(F):5'- ACCTTCGAAGATCACTGTGACTTG -3'
(R):5'- CCCTATGAATGTGATCAATGTGG -3'
Posted On 2018-05-21