Incidental Mutation 'R6482:Plxna4'
ID 517160
Institutional Source Beutler Lab
Gene Symbol Plxna4
Ensembl Gene ENSMUSG00000029765
Gene Name plexin A4
Synonyms Plxa4
MMRRC Submission
Accession Numbers

Genbank: NM_175750

Is this an essential gene? Possibly essential (E-score: 0.554) question?
Stock # R6482 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 32144268-32588192 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 32516737 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 315 (S315P)
Ref Sequence ENSEMBL: ENSMUSP00000110748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115096]
AlphaFold Q80UG2
Predicted Effect probably benign
Transcript: ENSMUST00000115096
AA Change: S315P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110748
Gene: ENSMUSG00000029765
AA Change: S315P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 50 490 2.3e-131 SMART
PSI 508 558 2.21e-14 SMART
PSI 654 701 2.44e-7 SMART
PSI 802 855 1.2e-6 SMART
IPT 856 950 7.25e-16 SMART
IPT 952 1036 4.1e-15 SMART
IPT 1038 1138 2.86e-14 SMART
IPT 1140 1229 6.88e-1 SMART
transmembrane domain 1237 1259 N/A INTRINSIC
Pfam:Plexin_cytopl 1310 1863 1.8e-264 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150314
Meta Mutation Damage Score 0.4512 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 100% (40/40)
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit defective trajecotory and projection of peripheral sensory axons and sympathetic ganglion axons and the formation of the anterior commissure and the barrels. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadvl T C 11: 70,011,562 I415V probably benign Het
Akap8l A G 17: 32,345,396 F6L possibly damaging Het
Ano3 T A 2: 110,697,055 N603Y probably damaging Het
Casp8ap2 T C 4: 32,634,813 S116P probably damaging Het
Ccdc110 A T 8: 45,942,788 Q572L probably benign Het
Chit1 T C 1: 134,143,242 S20P probably damaging Het
Col22a1 G A 15: 71,890,489 P107L possibly damaging Het
Dpys T C 15: 39,841,973 H248R probably damaging Het
Dsg2 A T 18: 20,601,314 K783I possibly damaging Het
Efnb2 A T 8: 8,620,637 V321E probably damaging Het
Fbxo11 A T 17: 88,012,658 Y209N probably benign Het
Gm21936 A G 12: 87,795,795 Y95C probably damaging Het
Gm35315 A T 5: 110,078,089 C495S possibly damaging Het
Hrh1 A G 6: 114,480,763 Q335R possibly damaging Het
Il12rb2 A G 6: 67,356,686 L203P probably damaging Het
Itgav T C 2: 83,794,270 S735P probably damaging Het
Klrg1 G T 6: 122,271,453 C162* probably null Het
Mcc T C 18: 44,445,864 S651G possibly damaging Het
Nkx2-2 T A 2: 147,185,976 I15F probably damaging Het
Nppa G A 4: 148,000,871 V13I probably benign Het
Olfr1104 G C 2: 87,022,525 F6L probably benign Het
Pde2a A G 7: 101,501,037 N228D probably benign Het
Pgpep1l C T 7: 68,239,067 probably null Het
Plekhg3 A G 12: 76,576,004 N673D probably benign Het
Psg21 A T 7: 18,654,739 probably null Het
Rnf111 T C 9: 70,429,607 T925A probably damaging Het
Rnf219 A T 14: 104,479,817 C373* probably null Het
Spag9 T C 11: 94,093,502 F734L possibly damaging Het
Tarbp1 A G 8: 126,450,695 V746A probably benign Het
Tmtc1 A G 6: 148,412,745 F119L probably benign Het
Ttc21b A G 2: 66,226,900 M576T probably benign Het
Usp48 T A 4: 137,634,921 V765E probably damaging Het
Vmn1r20 A G 6: 57,432,108 S140G probably benign Het
Vwde A G 6: 13,205,844 S235P probably damaging Het
Wapl A G 14: 34,692,692 S504G probably benign Het
Wnt5b A T 6: 119,433,612 L289Q possibly damaging Het
Zfp142 G A 1: 74,570,217 probably null Het
Zfp385b ATCTTCTTCTTCT ATCTTCTTCTTCTTCT 2: 77,719,648 probably benign Het
Zfp948 A G 17: 21,587,551 H335R probably benign Het
Other mutations in Plxna4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Plxna4 APN 6 32162091 missense probably damaging 1.00
IGL01395:Plxna4 APN 6 32239433 missense probably damaging 0.99
IGL01506:Plxna4 APN 6 32516535 missense probably damaging 1.00
IGL01606:Plxna4 APN 6 32158001 missense probably damaging 1.00
IGL01753:Plxna4 APN 6 32310478 missense probably benign 0.06
IGL01767:Plxna4 APN 6 32237678 missense possibly damaging 0.51
IGL01968:Plxna4 APN 6 32215204 missense possibly damaging 0.81
IGL02109:Plxna4 APN 6 32215641 missense probably benign
IGL02299:Plxna4 APN 6 32165156 missense probably benign 0.01
IGL02306:Plxna4 APN 6 32206124 missense probably benign 0.19
IGL02312:Plxna4 APN 6 32165117 missense possibly damaging 0.79
IGL02326:Plxna4 APN 6 32152905 missense probably damaging 0.99
IGL02658:Plxna4 APN 6 32185411 missense probably damaging 1.00
IGL02683:Plxna4 APN 6 32517606 missense probably benign 0.03
IGL02701:Plxna4 APN 6 32517559 missense probably benign 0.01
IGL02995:Plxna4 APN 6 32516595 missense probably damaging 1.00
IGL03030:Plxna4 APN 6 32202225 missense probably benign 0.01
IGL03264:Plxna4 APN 6 32178402 missense possibly damaging 0.64
IGL03304:Plxna4 APN 6 32165051 splice site probably benign
IGL03382:Plxna4 APN 6 32202194 missense probably benign 0.23
corona UTSW 6 32517264 missense probably damaging 1.00
Disposed UTSW 6 32516505 missense probably damaging 1.00
inclined UTSW 6 32237723 nonsense probably null
Slope UTSW 6 32234606 missense probably benign 0.00
G4846:Plxna4 UTSW 6 32192272 missense probably damaging 1.00
R0133:Plxna4 UTSW 6 32197074 missense probably benign 0.00
R0200:Plxna4 UTSW 6 32197088 missense probably damaging 0.99
R0308:Plxna4 UTSW 6 32237768 missense probably benign 0.01
R0468:Plxna4 UTSW 6 32215246 missense probably damaging 1.00
R0505:Plxna4 UTSW 6 32202119 missense probably benign
R0542:Plxna4 UTSW 6 32192297 missense probably damaging 1.00
R0548:Plxna4 UTSW 6 32158015 missense probably damaging 1.00
R0652:Plxna4 UTSW 6 32185501 missense probably damaging 1.00
R1144:Plxna4 UTSW 6 32197156 missense possibly damaging 0.58
R1190:Plxna4 UTSW 6 32251136 missense probably damaging 1.00
R1228:Plxna4 UTSW 6 32224152 splice site probably null
R1569:Plxna4 UTSW 6 32185475 missense possibly damaging 0.78
R1803:Plxna4 UTSW 6 32517444 missense probably damaging 0.98
R1832:Plxna4 UTSW 6 32197826 missense probably benign 0.01
R2068:Plxna4 UTSW 6 32517616 missense possibly damaging 0.66
R2157:Plxna4 UTSW 6 32516974 missense probably benign 0.00
R2842:Plxna4 UTSW 6 32215631 critical splice donor site probably null
R2849:Plxna4 UTSW 6 32185532 missense probably damaging 1.00
R2892:Plxna4 UTSW 6 32517037 missense probably damaging 1.00
R2930:Plxna4 UTSW 6 32165780 missense probably damaging 1.00
R3892:Plxna4 UTSW 6 32215654 missense probably damaging 1.00
R4065:Plxna4 UTSW 6 32236365 nonsense probably null
R4276:Plxna4 UTSW 6 32200948 missense probably benign 0.29
R4307:Plxna4 UTSW 6 32163509 missense probably damaging 0.99
R4331:Plxna4 UTSW 6 32150545 nonsense probably null
R4478:Plxna4 UTSW 6 32196133 missense possibly damaging 0.89
R4529:Plxna4 UTSW 6 32496896 critical splice acceptor site probably null
R4566:Plxna4 UTSW 6 32517403 missense probably benign 0.00
R4568:Plxna4 UTSW 6 32152938 missense probably damaging 1.00
R4664:Plxna4 UTSW 6 32516950 missense possibly damaging 0.88
R4685:Plxna4 UTSW 6 32165844 missense probably damaging 1.00
R4701:Plxna4 UTSW 6 32516688 missense probably damaging 0.99
R4939:Plxna4 UTSW 6 32165762 missense probably damaging 1.00
R5153:Plxna4 UTSW 6 32224159 splice site probably null
R5181:Plxna4 UTSW 6 32516997 missense probably damaging 1.00
R5256:Plxna4 UTSW 6 32251072 missense probably benign 0.03
R5259:Plxna4 UTSW 6 32517021 missense possibly damaging 0.89
R5306:Plxna4 UTSW 6 32206121 missense probably damaging 0.99
R5487:Plxna4 UTSW 6 32517283 missense probably damaging 1.00
R5510:Plxna4 UTSW 6 32178358 missense probably damaging 0.96
R5542:Plxna4 UTSW 6 32206230 missense probably damaging 1.00
R5567:Plxna4 UTSW 6 32157980 missense possibly damaging 0.61
R5634:Plxna4 UTSW 6 32237723 nonsense probably null
R5653:Plxna4 UTSW 6 32517616 missense possibly damaging 0.66
R5665:Plxna4 UTSW 6 32215722 missense probably damaging 1.00
R5845:Plxna4 UTSW 6 32237776 missense probably damaging 1.00
R5909:Plxna4 UTSW 6 32517246 missense probably damaging 1.00
R5938:Plxna4 UTSW 6 32234606 missense probably benign 0.00
R5973:Plxna4 UTSW 6 32251065 splice site probably null
R6433:Plxna4 UTSW 6 32215678 missense probably damaging 0.97
R6560:Plxna4 UTSW 6 32215678 missense probably damaging 0.97
R6721:Plxna4 UTSW 6 32200859 missense probably benign 0.26
R6810:Plxna4 UTSW 6 32310522 missense probably benign 0.18
R6985:Plxna4 UTSW 6 32237708 missense probably damaging 1.00
R7024:Plxna4 UTSW 6 32192269 missense probably damaging 1.00
R7046:Plxna4 UTSW 6 32516505 missense probably damaging 1.00
R7137:Plxna4 UTSW 6 32517264 missense probably damaging 1.00
R7163:Plxna4 UTSW 6 32496756 missense probably benign 0.01
R7199:Plxna4 UTSW 6 32215178 nonsense probably null
R7248:Plxna4 UTSW 6 32162160 missense probably damaging 0.99
R7260:Plxna4 UTSW 6 32239520 missense possibly damaging 0.79
R7361:Plxna4 UTSW 6 32196122 critical splice donor site probably null
R7383:Plxna4 UTSW 6 32152799 critical splice donor site probably null
R7405:Plxna4 UTSW 6 32196319 missense probably benign 0.00
R7516:Plxna4 UTSW 6 32237768 missense probably benign 0.00
R7635:Plxna4 UTSW 6 32496741 missense probably damaging 0.98
R7754:Plxna4 UTSW 6 32152872 missense probably damaging 1.00
R7763:Plxna4 UTSW 6 32223980 missense probably damaging 0.99
R7789:Plxna4 UTSW 6 32206233 critical splice acceptor site probably null
R8167:Plxna4 UTSW 6 32517046 missense probably damaging 0.99
R8191:Plxna4 UTSW 6 32516950 missense possibly damaging 0.88
R8225:Plxna4 UTSW 6 32162103 missense probably damaging 1.00
R8284:Plxna4 UTSW 6 32152854 missense probably benign 0.25
R8305:Plxna4 UTSW 6 32211065 missense possibly damaging 0.81
R8438:Plxna4 UTSW 6 32202180 missense probably damaging 1.00
R8493:Plxna4 UTSW 6 32215712 missense probably benign 0.27
R8714:Plxna4 UTSW 6 32163444 nonsense probably null
R8759:Plxna4 UTSW 6 32192341 missense probably damaging 1.00
R8822:Plxna4 UTSW 6 32150496 missense possibly damaging 0.89
R8844:Plxna4 UTSW 6 32197091 missense probably benign 0.11
R8974:Plxna4 UTSW 6 32239512 missense possibly damaging 0.79
R9020:Plxna4 UTSW 6 32234562 missense possibly damaging 0.90
R9144:Plxna4 UTSW 6 32185561 missense possibly damaging 0.77
R9206:Plxna4 UTSW 6 32517444 missense probably damaging 0.98
R9208:Plxna4 UTSW 6 32517444 missense probably damaging 0.98
R9257:Plxna4 UTSW 6 32162083 missense probably damaging 0.99
R9269:Plxna4 UTSW 6 32178380 missense probably benign 0.00
R9411:Plxna4 UTSW 6 32182747 missense probably damaging 1.00
R9469:Plxna4 UTSW 6 32517591 missense probably benign
R9583:Plxna4 UTSW 6 32215234 missense possibly damaging 0.78
R9647:Plxna4 UTSW 6 32251109 missense probably damaging 1.00
R9695:Plxna4 UTSW 6 32206121 missense probably benign 0.02
R9801:Plxna4 UTSW 6 32163591 critical splice acceptor site probably null
V1024:Plxna4 UTSW 6 32234574 missense probably damaging 1.00
X0027:Plxna4 UTSW 6 32517044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATAACAGGACTGCAGGCGG -3'
(R):5'- CTACTACGTCTATGGCTTCAGC -3'

Sequencing Primer
(F):5'- AGGCGGTCCTTAATGCGATC -3'
(R):5'- CAGCAGTGGCAATTTTGTCTAC -3'
Posted On 2018-05-21