Incidental Mutation 'R6482:Vmn1r20'
ID 517161
Institutional Source Beutler Lab
Gene Symbol Vmn1r20
Ensembl Gene ENSMUSG00000115253
Gene Name vomeronasal 1 receptor 20
Synonyms Gm5569
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.506) question?
Stock # R6482 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 57428930-57435261 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 57432108 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 140 (S140G)
Ref Sequence ENSEMBL: ENSMUSP00000153815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176085] [ENSMUST00000226808] [ENSMUST00000227909]
AlphaFold K7N778
Predicted Effect probably benign
Transcript: ENSMUST00000176085
AA Change: S140G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000134973
Gene: ENSMUSG00000093679
AA Change: S140G

DomainStartEndE-ValueType
Pfam:V1R 28 293 2.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226808
AA Change: S140G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000227909
AA Change: S140G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadvl T C 11: 70,011,562 I415V probably benign Het
Akap8l A G 17: 32,345,396 F6L possibly damaging Het
Ano3 T A 2: 110,697,055 N603Y probably damaging Het
Casp8ap2 T C 4: 32,634,813 S116P probably damaging Het
Ccdc110 A T 8: 45,942,788 Q572L probably benign Het
Chit1 T C 1: 134,143,242 S20P probably damaging Het
Col22a1 G A 15: 71,890,489 P107L possibly damaging Het
Dpys T C 15: 39,841,973 H248R probably damaging Het
Dsg2 A T 18: 20,601,314 K783I possibly damaging Het
Efnb2 A T 8: 8,620,637 V321E probably damaging Het
Fbxo11 A T 17: 88,012,658 Y209N probably benign Het
Gm21936 A G 12: 87,795,795 Y95C probably damaging Het
Gm35315 A T 5: 110,078,089 C495S possibly damaging Het
Hrh1 A G 6: 114,480,763 Q335R possibly damaging Het
Il12rb2 A G 6: 67,356,686 L203P probably damaging Het
Itgav T C 2: 83,794,270 S735P probably damaging Het
Klrg1 G T 6: 122,271,453 C162* probably null Het
Mcc T C 18: 44,445,864 S651G possibly damaging Het
Nkx2-2 T A 2: 147,185,976 I15F probably damaging Het
Nppa G A 4: 148,000,871 V13I probably benign Het
Olfr1104 G C 2: 87,022,525 F6L probably benign Het
Pde2a A G 7: 101,501,037 N228D probably benign Het
Pgpep1l C T 7: 68,239,067 probably null Het
Plekhg3 A G 12: 76,576,004 N673D probably benign Het
Plxna4 A G 6: 32,516,737 S315P probably benign Het
Psg21 A T 7: 18,654,739 probably null Het
Rnf111 T C 9: 70,429,607 T925A probably damaging Het
Rnf219 A T 14: 104,479,817 C373* probably null Het
Spag9 T C 11: 94,093,502 F734L possibly damaging Het
Tarbp1 A G 8: 126,450,695 V746A probably benign Het
Tmtc1 A G 6: 148,412,745 F119L probably benign Het
Ttc21b A G 2: 66,226,900 M576T probably benign Het
Usp48 T A 4: 137,634,921 V765E probably damaging Het
Vwde A G 6: 13,205,844 S235P probably damaging Het
Wapl A G 14: 34,692,692 S504G probably benign Het
Wnt5b A T 6: 119,433,612 L289Q possibly damaging Het
Zfp142 G A 1: 74,570,217 probably null Het
Zfp385b ATCTTCTTCTTCT ATCTTCTTCTTCTTCT 2: 77,719,648 probably benign Het
Zfp948 A G 17: 21,587,551 H335R probably benign Het
Other mutations in Vmn1r20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Vmn1r20 APN 6 57431740 missense probably damaging 1.00
IGL02622:Vmn1r20 APN 6 57432598 missense probably damaging 0.99
IGL02636:Vmn1r20 APN 6 57431761 missense probably benign
R0006:Vmn1r20 UTSW 6 57432305 missense probably damaging 0.99
R0079:Vmn1r20 UTSW 6 57431792 missense possibly damaging 0.70
R0200:Vmn1r20 UTSW 6 57432099 missense probably damaging 0.96
R1675:Vmn1r20 UTSW 6 57431952 missense probably benign 0.00
R1734:Vmn1r20 UTSW 6 57432300 missense probably damaging 1.00
R1883:Vmn1r20 UTSW 6 57432321 missense probably benign 0.14
R2049:Vmn1r20 UTSW 6 57431958 missense probably damaging 1.00
R2307:Vmn1r20 UTSW 6 57432136 missense probably benign 0.03
R2346:Vmn1r20 UTSW 6 57431946 missense possibly damaging 0.83
R4405:Vmn1r20 UTSW 6 57432057 missense probably benign 0.02
R4946:Vmn1r20 UTSW 6 57432174 missense probably damaging 0.98
R5259:Vmn1r20 UTSW 6 57432065 nonsense probably null
R5321:Vmn1r20 UTSW 6 57432442 missense probably benign 0.21
R5911:Vmn1r20 UTSW 6 57431789 missense probably benign 0.16
R6042:Vmn1r20 UTSW 6 57432406 missense possibly damaging 0.90
R6298:Vmn1r20 UTSW 6 57432127 missense probably benign
R6314:Vmn1r20 UTSW 6 57432057 missense probably benign 0.00
R6331:Vmn1r20 UTSW 6 57431670 splice site probably null
R9161:Vmn1r20 UTSW 6 57431774 missense probably benign 0.00
R9165:Vmn1r20 UTSW 6 57432261 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGTAGGGTGATGAGATGCCTC -3'
(R):5'- GATGCTATGAAGGTGCTTGCAC -3'

Sequencing Primer
(F):5'- GTGATGAGATGCCTCTCTATCTGCAC -3'
(R):5'- GCACTGCCTCTGATGTCTACATAAG -3'
Posted On 2018-05-21