Mutagenetix > Incidental Mutation

Incidental Mutation 'R6482:Il12rb2'

517162

Institutional Source

Beutler Lab

Gene Symbol

Il12rb2

Ensembl Gene

ENSMUSG00000018341

Gene Name

interleukin 12 receptor, beta 2

Synonyms

IL-12RB2, Ifnm, A930027I18Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6482 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

67291318-67376188 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 67356686 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 203 (L203P)

Ref Sequence

ENSEMBL: ENSMUSP00000010605 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018485]

AlphaFold

P97378

Predicted Effect

probably damaging
Transcript: ENSMUST00000018485
AA Change: L203P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000010605
Gene: ENSMUSG00000018341
AA Change: L203P

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Lep_receptor_Ig	28	120	6.4e-20	PFAM
FN3	137	225	2.41e0	SMART
FN3	240	320	3.4e-4	SMART
Blast:FN3	340	434	2e-40	BLAST
FN3	436	525	3.17e-4	SMART
FN3	534	622	6.45e-5	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.6%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I transmembrane protein identified as a subunit of the interleukin 12 receptor complex. The coexpression of this and IL12RB1 proteins was shown to lead to the formation of high-affinity IL12 binding sites and reconstitution of IL12 dependent signaling. The expression of this gene is up-regulated by interferon gamma in Th1 cells, and plays a role in Th1 cell differentiation. The up-regulation of this gene is found to be associated with a number of infectious diseases, such as Crohn's disease and leprosy, which is thought to contribute to the inflammatory response and host defense. Several transcript variants encoding different isoforms and non-protein coding transcripts have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele have defects in IFN-gamma production and cytotoxic T lymphocyte and NK cytotoxicity, develop an autoimmune/lymphoproliferative disorder associated with higher susceptibility to spontaneous tumor formation, but show reduced in vivo growth of B16 melanoma tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadvl	T	C	11: 70,011,562	I415V	probably benign	Het
Akap8l	A	G	17: 32,345,396	F6L	possibly damaging	Het
Ano3	T	A	2: 110,697,055	N603Y	probably damaging	Het
Casp8ap2	T	C	4: 32,634,813	S116P	probably damaging	Het
Ccdc110	A	T	8: 45,942,788	Q572L	probably benign	Het
Chit1	T	C	1: 134,143,242	S20P	probably damaging	Het
Col22a1	G	A	15: 71,890,489	P107L	possibly damaging	Het
Dpys	T	C	15: 39,841,973	H248R	probably damaging	Het
Dsg2	A	T	18: 20,601,314	K783I	possibly damaging	Het
Efnb2	A	T	8: 8,620,637	V321E	probably damaging	Het
Fbxo11	A	T	17: 88,012,658	Y209N	probably benign	Het
Gm21936	A	G	12: 87,795,795	Y95C	probably damaging	Het
Gm35315	A	T	5: 110,078,089	C495S	possibly damaging	Het
Hrh1	A	G	6: 114,480,763	Q335R	possibly damaging	Het
Itgav	T	C	2: 83,794,270	S735P	probably damaging	Het
Klrg1	G	T	6: 122,271,453	C162*	probably null	Het
Mcc	T	C	18: 44,445,864	S651G	possibly damaging	Het
Nkx2-2	T	A	2: 147,185,976	I15F	probably damaging	Het
Nppa	G	A	4: 148,000,871	V13I	probably benign	Het
Olfr1104	G	C	2: 87,022,525	F6L	probably benign	Het
Pde2a	A	G	7: 101,501,037	N228D	probably benign	Het
Pgpep1l	C	T	7: 68,239,067		probably null	Het
Plekhg3	A	G	12: 76,576,004	N673D	probably benign	Het
Plxna4	A	G	6: 32,516,737	S315P	probably benign	Het
Psg21	A	T	7: 18,654,739		probably null	Het
Rnf111	T	C	9: 70,429,607	T925A	probably damaging	Het
Rnf219	A	T	14: 104,479,817	C373*	probably null	Het
Spag9	T	C	11: 94,093,502	F734L	possibly damaging	Het
Tarbp1	A	G	8: 126,450,695	V746A	probably benign	Het
Tmtc1	A	G	6: 148,412,745	F119L	probably benign	Het
Ttc21b	A	G	2: 66,226,900	M576T	probably benign	Het
Usp48	T	A	4: 137,634,921	V765E	probably damaging	Het
Vmn1r20	A	G	6: 57,432,108	S140G	probably benign	Het
Vwde	A	G	6: 13,205,844	S235P	probably damaging	Het
Wapl	A	G	14: 34,692,692	S504G	probably benign	Het
Wnt5b	A	T	6: 119,433,612	L289Q	possibly damaging	Het
Zfp142	G	A	1: 74,570,217		probably null	Het
Zfp385b	ATCTTCTTCTTCT	ATCTTCTTCTTCTTCT	2: 77,719,648		probably benign	Het
Zfp948	A	G	17: 21,587,551	H335R	probably benign	Het

Other mutations in Il12rb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00584:Il12rb2	APN	6	67357692	missense	probably damaging	0.98
IGL00767:Il12rb2	APN	6	67303562	missense	possibly damaging	0.63
IGL00835:Il12rb2	APN	6	67360567	missense	probably damaging	0.99
IGL00864:Il12rb2	APN	6	67336754	missense	probably benign
IGL00965:Il12rb2	APN	6	67360577	missense	probably damaging	0.98
IGL01161:Il12rb2	APN	6	67361865	splice site	probably benign
IGL01980:Il12rb2	APN	6	67360535	missense	probably benign
IGL02246:Il12rb2	APN	6	67308956	critical splice donor site	probably null
IGL02807:Il12rb2	APN	6	67351316	missense	probably damaging	1.00
R0003:Il12rb2	UTSW	6	67316286	missense	probably damaging	1.00
R0022:Il12rb2	UTSW	6	67298919	missense	probably damaging	0.99
R0022:Il12rb2	UTSW	6	67298919	missense	probably damaging	0.99
R0079:Il12rb2	UTSW	6	67361905	missense	probably benign	0.00
R0462:Il12rb2	UTSW	6	67303610	missense	possibly damaging	0.95
R0709:Il12rb2	UTSW	6	67298904	splice site	probably benign
R0828:Il12rb2	UTSW	6	67356707	missense	probably benign
R1051:Il12rb2	UTSW	6	67356735	missense	probably benign
R1191:Il12rb2	UTSW	6	67298216	missense	possibly damaging	0.90
R1446:Il12rb2	UTSW	6	67309143	missense	probably benign
R1559:Il12rb2	UTSW	6	67356592	missense	probably benign	0.12
R1677:Il12rb2	UTSW	6	67303501	missense	probably damaging	1.00
R1689:Il12rb2	UTSW	6	67336760	missense	probably benign	0.01
R1907:Il12rb2	UTSW	6	67295286	nonsense	probably null
R1952:Il12rb2	UTSW	6	67292316	missense	probably damaging	0.99
R2048:Il12rb2	UTSW	6	67360545	missense	probably benign	0.05
R2074:Il12rb2	UTSW	6	67360552	missense	probably damaging	1.00
R2351:Il12rb2	UTSW	6	67361944	nonsense	probably null
R2358:Il12rb2	UTSW	6	67298195	missense	probably damaging	0.96
R2680:Il12rb2	UTSW	6	67354805	missense	possibly damaging	0.94
R2920:Il12rb2	UTSW	6	67360568	missense	probably damaging	0.96
R3107:Il12rb2	UTSW	6	67360798	missense	probably damaging	1.00
R4420:Il12rb2	UTSW	6	67316410	splice site	probably null
R4838:Il12rb2	UTSW	6	67309137	missense	probably damaging	1.00
R5391:Il12rb2	UTSW	6	67292420	missense	probably benign	0.24
R5532:Il12rb2	UTSW	6	67292262	missense	probably damaging	1.00
R5696:Il12rb2	UTSW	6	67295278	missense	possibly damaging	0.94
R5704:Il12rb2	UTSW	6	67292213	missense	possibly damaging	0.53
R5891:Il12rb2	UTSW	6	67360690	missense	probably damaging	0.97
R6749:Il12rb2	UTSW	6	67361966	start gained	probably benign
R6813:Il12rb2	UTSW	6	67292374	missense	probably damaging	0.98
R6957:Il12rb2	UTSW	6	67292652	missense	possibly damaging	0.60
R7312:Il12rb2	UTSW	6	67356633	missense	probably benign	0.29
R7361:Il12rb2	UTSW	6	67303466	missense	possibly damaging	0.48
R7813:Il12rb2	UTSW	6	67356651	missense	possibly damaging	0.72
R7992:Il12rb2	UTSW	6	67351327	nonsense	probably null
R8422:Il12rb2	UTSW	6	67360816	missense	probably benign	0.20
R8752:Il12rb2	UTSW	6	67351281	missense	probably damaging	1.00
R9648:Il12rb2	UTSW	6	67356603	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- ATAGCCTTGTACTTTGTCTGTAGC -3'
(R):5'- AGACCAGCCTTAAACCGTCTG -3'

Sequencing Primer
(F):5'- AGCTTCTGTCTCCTTGAAAATAAC -3'
(R):5'- AGCCTTAAACCGTCTGTCTGG -3'

Posted On

2018-05-21