Incidental Mutation 'R6482:Hrh1'
ID517163
Institutional Source Beutler Lab
Gene Symbol Hrh1
Ensembl Gene ENSMUSG00000053004
Gene Namehistamine receptor H1
SynonymsHir, Bphs
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6482 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location114397936-114483296 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114480763 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 335 (Q335R)
Ref Sequence ENSEMBL: ENSMUSP00000124460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088987] [ENSMUST00000160212] [ENSMUST00000160780] [ENSMUST00000161220] [ENSMUST00000161650]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088987
AA Change: Q335R

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000086383
Gene: ENSMUSG00000053004
AA Change: Q335R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 38 228 2.4e-6 PFAM
Pfam:7tm_1 44 469 1.1e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160212
Predicted Effect possibly damaging
Transcript: ENSMUST00000160780
AA Change: Q335R

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124320
Gene: ENSMUSG00000053004
AA Change: Q335R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 38 228 2.4e-6 PFAM
Pfam:7tm_1 44 469 3.3e-69 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000161220
AA Change: Q335R

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124037
Gene: ENSMUSG00000053004
AA Change: Q335R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 38 228 2.4e-6 PFAM
Pfam:7tm_1 44 469 1.1e-72 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000161650
AA Change: Q335R

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124460
Gene: ENSMUSG00000053004
AA Change: Q335R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 38 228 2.4e-6 PFAM
Pfam:7tm_1 44 469 1.1e-72 PFAM
Meta Mutation Damage Score 0.1095 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histamine is a ubiquitous messenger molecule released from mast cells, enterochromaffin-like cells, and neurons. Its various actions are mediated by histamine receptors H1, H2, H3 and H4. The protein encoded by this gene is an integral membrane protein and belongs to the G protein-coupled receptor superfamily. It mediates the contraction of smooth muscles, the increase in capillary permeability due to contraction of terminal venules, the release of catecholamine from adrenal medulla, and neurotransmission in the central nervous system. It has been associated with multiple processes, including memory and learning, circadian rhythm, and thermoregulation. It is also known to contribute to the pathophysiology of allergic diseases such as atopic dermatitis, asthma, anaphylaxis and allergic rhinitis. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygous null mutants show decrease in exploratory behavior, diurnal activity, aggression, anxiety, serotonin release, respiratory reaction to temperature and leptin response. Natural variants affect B. pertussis induced vasoactive amine sensitization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadvl T C 11: 70,011,562 I415V probably benign Het
Akap8l A G 17: 32,345,396 F6L possibly damaging Het
Ano3 T A 2: 110,697,055 N603Y probably damaging Het
Casp8ap2 T C 4: 32,634,813 S116P probably damaging Het
Ccdc110 A T 8: 45,942,788 Q572L probably benign Het
Chit1 T C 1: 134,143,242 S20P probably damaging Het
Col22a1 G A 15: 71,890,489 P107L possibly damaging Het
Dpys T C 15: 39,841,973 H248R probably damaging Het
Dsg2 A T 18: 20,601,314 K783I possibly damaging Het
Efnb2 A T 8: 8,620,637 V321E probably damaging Het
Fbxo11 A T 17: 88,012,658 Y209N probably benign Het
Gm21936 A G 12: 87,795,795 Y95C probably damaging Het
Gm35315 A T 5: 110,078,089 C495S possibly damaging Het
Il12rb2 A G 6: 67,356,686 L203P probably damaging Het
Itgav T C 2: 83,794,270 S735P probably damaging Het
Klrg1 G T 6: 122,271,453 C162* probably null Het
Mcc T C 18: 44,445,864 S651G possibly damaging Het
Nkx2-2 T A 2: 147,185,976 I15F probably damaging Het
Nppa G A 4: 148,000,871 V13I probably benign Het
Olfr1104 G C 2: 87,022,525 F6L probably benign Het
Pde2a A G 7: 101,501,037 N228D probably benign Het
Pgpep1l C T 7: 68,239,067 probably null Het
Plekhg3 A G 12: 76,576,004 N673D probably benign Het
Plxna4 A G 6: 32,516,737 S315P probably benign Het
Psg21 A T 7: 18,654,739 probably null Het
Rnf111 T C 9: 70,429,607 T925A probably damaging Het
Rnf219 A T 14: 104,479,817 C373* probably null Het
Spag9 T C 11: 94,093,502 F734L possibly damaging Het
Tarbp1 A G 8: 126,450,695 V746A probably benign Het
Tmtc1 A G 6: 148,412,745 F119L probably benign Het
Ttc21b A G 2: 66,226,900 M576T probably benign Het
Usp48 T A 4: 137,634,921 V765E probably damaging Het
Vmn1r20 A G 6: 57,432,108 S140G probably benign Het
Vwde A G 6: 13,205,844 S235P probably damaging Het
Wapl A G 14: 34,692,692 S504G probably benign Het
Wnt5b A T 6: 119,433,612 L289Q possibly damaging Het
Zfp142 G A 1: 74,570,217 probably null Het
Zfp385b ATCTTCTTCTTCT ATCTTCTTCTTCTTCT 2: 77,719,648 probably benign Het
Zfp948 A G 17: 21,587,551 H335R probably benign Het
Other mutations in Hrh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Hrh1 APN 6 114480322 missense probably damaging 0.99
IGL01372:Hrh1 APN 6 114479997 missense probably damaging 1.00
IGL01453:Hrh1 APN 6 114481162 missense probably damaging 1.00
IGL01519:Hrh1 APN 6 114480301 missense probably damaging 1.00
IGL02142:Hrh1 APN 6 114480243 missense probably damaging 1.00
IGL02352:Hrh1 APN 6 114480443 missense probably benign 0.43
IGL02359:Hrh1 APN 6 114480443 missense probably benign 0.43
FR4737:Hrh1 UTSW 6 114481123 missense possibly damaging 0.95
R0335:Hrh1 UTSW 6 114480232 missense probably damaging 1.00
R0635:Hrh1 UTSW 6 114480145 missense probably damaging 1.00
R1493:Hrh1 UTSW 6 114480877 missense probably damaging 0.98
R2283:Hrh1 UTSW 6 114480439 missense probably benign 0.00
R3870:Hrh1 UTSW 6 114480919 missense probably damaging 1.00
R4124:Hrh1 UTSW 6 114480619 missense probably benign 0.06
R4254:Hrh1 UTSW 6 114480001 missense probably damaging 1.00
R4764:Hrh1 UTSW 6 114480535 missense probably benign 0.00
R5270:Hrh1 UTSW 6 114481218 missense possibly damaging 0.75
R6189:Hrh1 UTSW 6 114479998 missense probably damaging 1.00
R7495:Hrh1 UTSW 6 114480673 missense probably benign 0.05
R7683:Hrh1 UTSW 6 114479787 missense probably benign
R8041:Hrh1 UTSW 6 114479917 missense not run
Predicted Primers PCR Primer
(F):5'- AGGTCTGGATCAGAAGTCAAC -3'
(R):5'- ATACTGTCTGGAATGTGAGCGG -3'

Sequencing Primer
(F):5'- GTCTGGATCAGAAGTCAACATCTG -3'
(R):5'- GAGCCTCTTCCAGGTGACTTTG -3'
Posted On2018-05-21