Incidental Mutation 'R6482:Wnt5b'
ID 517164
Institutional Source Beutler Lab
Gene Symbol Wnt5b
Ensembl Gene ENSMUSG00000030170
Gene Name wingless-type MMTV integration site family, member 5B
Synonyms Wnt-5b
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6482 (G1)
Quality Score 87.0076
Status Validated
Chromosome 6
Chromosomal Location 119432531-119544347 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 119433612 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 289 (L289Q)
Ref Sequence ENSEMBL: ENSMUSP00000137065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117171] [ENSMUST00000118120] [ENSMUST00000119369] [ENSMUST00000178696]
AlphaFold P22726
Predicted Effect possibly damaging
Transcript: ENSMUST00000117171
AA Change: L289Q

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113188
Gene: ENSMUSG00000030170
AA Change: L289Q

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
WNT1 50 359 3.47e-215 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118120
AA Change: L251Q

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112819
Gene: ENSMUSG00000030170
AA Change: L251Q

DomainStartEndE-ValueType
WNT1 12 321 3.47e-215 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119369
AA Change: L302Q

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112448
Gene: ENSMUSG00000030170
AA Change: L302Q

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
WNT1 63 372 3.47e-215 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000178696
AA Change: L289Q

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137065
Gene: ENSMUSG00000030170
AA Change: L289Q

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
WNT1 50 359 3.47e-215 SMART
Meta Mutation Damage Score 0.1611 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 94% and 80% amino acid identity to the mouse Wnt5b protein and the human WNT5A protein, respectively. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal numbers of thoracic motor neurons and proportions of motor columnar subtypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadvl T C 11: 70,011,562 I415V probably benign Het
Akap8l A G 17: 32,345,396 F6L possibly damaging Het
Ano3 T A 2: 110,697,055 N603Y probably damaging Het
Casp8ap2 T C 4: 32,634,813 S116P probably damaging Het
Ccdc110 A T 8: 45,942,788 Q572L probably benign Het
Chit1 T C 1: 134,143,242 S20P probably damaging Het
Col22a1 G A 15: 71,890,489 P107L possibly damaging Het
Dpys T C 15: 39,841,973 H248R probably damaging Het
Dsg2 A T 18: 20,601,314 K783I possibly damaging Het
Efnb2 A T 8: 8,620,637 V321E probably damaging Het
Fbxo11 A T 17: 88,012,658 Y209N probably benign Het
Gm21936 A G 12: 87,795,795 Y95C probably damaging Het
Gm35315 A T 5: 110,078,089 C495S possibly damaging Het
Hrh1 A G 6: 114,480,763 Q335R possibly damaging Het
Il12rb2 A G 6: 67,356,686 L203P probably damaging Het
Itgav T C 2: 83,794,270 S735P probably damaging Het
Klrg1 G T 6: 122,271,453 C162* probably null Het
Mcc T C 18: 44,445,864 S651G possibly damaging Het
Nkx2-2 T A 2: 147,185,976 I15F probably damaging Het
Nppa G A 4: 148,000,871 V13I probably benign Het
Olfr1104 G C 2: 87,022,525 F6L probably benign Het
Pde2a A G 7: 101,501,037 N228D probably benign Het
Pgpep1l C T 7: 68,239,067 probably null Het
Plekhg3 A G 12: 76,576,004 N673D probably benign Het
Plxna4 A G 6: 32,516,737 S315P probably benign Het
Psg21 A T 7: 18,654,739 probably null Het
Rnf111 T C 9: 70,429,607 T925A probably damaging Het
Rnf219 A T 14: 104,479,817 C373* probably null Het
Spag9 T C 11: 94,093,502 F734L possibly damaging Het
Tarbp1 A G 8: 126,450,695 V746A probably benign Het
Tmtc1 A G 6: 148,412,745 F119L probably benign Het
Ttc21b A G 2: 66,226,900 M576T probably benign Het
Usp48 T A 4: 137,634,921 V765E probably damaging Het
Vmn1r20 A G 6: 57,432,108 S140G probably benign Het
Vwde A G 6: 13,205,844 S235P probably damaging Het
Wapl A G 14: 34,692,692 S504G probably benign Het
Zfp142 G A 1: 74,570,217 probably null Het
Zfp385b ATCTTCTTCTTCT ATCTTCTTCTTCTTCT 2: 77,719,648 probably benign Het
Zfp948 A G 17: 21,587,551 H335R probably benign Het
Other mutations in Wnt5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01590:Wnt5b APN 6 119440554 missense possibly damaging 0.70
IGL01822:Wnt5b APN 6 119433472 missense probably damaging 1.00
Blizzard UTSW 6 119446358 missense probably damaging 1.00
Invierno UTSW 6 119440311 missense probably damaging 1.00
luftmensch UTSW 6 119433852 missense probably damaging 0.97
R0557:Wnt5b UTSW 6 119433818 missense probably damaging 1.00
R0732:Wnt5b UTSW 6 119446582 nonsense probably null
R1472:Wnt5b UTSW 6 119433481 missense probably damaging 1.00
R1673:Wnt5b UTSW 6 119446354 missense probably benign 0.19
R4202:Wnt5b UTSW 6 119440311 missense probably damaging 1.00
R5100:Wnt5b UTSW 6 119440488 missense probably benign 0.20
R5264:Wnt5b UTSW 6 119433852 missense probably damaging 0.97
R5393:Wnt5b UTSW 6 119440433 missense probably damaging 1.00
R5394:Wnt5b UTSW 6 119440322 missense probably damaging 0.98
R5482:Wnt5b UTSW 6 119446431 missense probably benign 0.19
R5741:Wnt5b UTSW 6 119433729 missense probably damaging 1.00
R5902:Wnt5b UTSW 6 119448238 missense probably benign 0.00
R6005:Wnt5b UTSW 6 119433654 missense probably benign 0.04
R6061:Wnt5b UTSW 6 119433642 missense probably damaging 0.98
R6208:Wnt5b UTSW 6 119446512 missense probably damaging 1.00
R6405:Wnt5b UTSW 6 119433496 missense probably benign 0.06
R6478:Wnt5b UTSW 6 119433790 missense probably damaging 1.00
R7047:Wnt5b UTSW 6 119448256 start gained probably benign
R7338:Wnt5b UTSW 6 119448131 splice site probably null
R8044:Wnt5b UTSW 6 119446358 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTGCATCTGACAAAGCAACACC -3'
(R):5'- ATGTCGCCTGCAAATGTCAC -3'

Sequencing Primer
(F):5'- ACACCAGTGGAACCTGCAGTG -3'
(R):5'- TGCAAATGTCACGGAGTCTC -3'
Posted On 2018-05-21