Mutagenetix > Incidental Mutation

Incidental Mutation 'R6482:Wnt5b'

517164

Institutional Source

Beutler Lab

Gene Symbol

Wnt5b

Ensembl Gene

ENSMUSG00000030170

Gene Name

wingless-type MMTV integration site family, member 5B

Synonyms

Wnt-5b

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6482 (G1)

Quality Score

87.0076

Status

Validated

Chromosome

Chromosomal Location

119432531-119544347 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 119433612 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 289 (L289Q)

Ref Sequence

ENSEMBL: ENSMUSP00000137065 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117171] [ENSMUST00000118120] [ENSMUST00000119369] [ENSMUST00000178696]

AlphaFold

P22726

Predicted Effect

possibly damaging
Transcript: ENSMUST00000117171
AA Change: L289Q

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000113188
Gene: ENSMUSG00000030170
AA Change: L289Q

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
WNT1	50	359	3.47e-215	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000118120
AA Change: L251Q

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000112819
Gene: ENSMUSG00000030170
AA Change: L251Q

Domain	Start	End	E-Value	Type
WNT1	12	321	3.47e-215	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000119369
AA Change: L302Q

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000112448
Gene: ENSMUSG00000030170
AA Change: L302Q

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
WNT1	63	372	3.47e-215	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000178696
AA Change: L289Q

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000137065
Gene: ENSMUSG00000030170
AA Change: L289Q

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
WNT1	50	359	3.47e-215	SMART

Meta Mutation Damage Score

0.1611

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.6%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 94% and 80% amino acid identity to the mouse Wnt5b protein and the human WNT5A protein, respectively. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal numbers of thoracic motor neurons and proportions of motor columnar subtypes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadvl	T	C	11: 70,011,562	I415V	probably benign	Het
Akap8l	A	G	17: 32,345,396	F6L	possibly damaging	Het
Ano3	T	A	2: 110,697,055	N603Y	probably damaging	Het
Casp8ap2	T	C	4: 32,634,813	S116P	probably damaging	Het
Ccdc110	A	T	8: 45,942,788	Q572L	probably benign	Het
Chit1	T	C	1: 134,143,242	S20P	probably damaging	Het
Col22a1	G	A	15: 71,890,489	P107L	possibly damaging	Het
Dpys	T	C	15: 39,841,973	H248R	probably damaging	Het
Dsg2	A	T	18: 20,601,314	K783I	possibly damaging	Het
Efnb2	A	T	8: 8,620,637	V321E	probably damaging	Het
Fbxo11	A	T	17: 88,012,658	Y209N	probably benign	Het
Gm21936	A	G	12: 87,795,795	Y95C	probably damaging	Het
Gm35315	A	T	5: 110,078,089	C495S	possibly damaging	Het
Hrh1	A	G	6: 114,480,763	Q335R	possibly damaging	Het
Il12rb2	A	G	6: 67,356,686	L203P	probably damaging	Het
Itgav	T	C	2: 83,794,270	S735P	probably damaging	Het
Klrg1	G	T	6: 122,271,453	C162*	probably null	Het
Mcc	T	C	18: 44,445,864	S651G	possibly damaging	Het
Nkx2-2	T	A	2: 147,185,976	I15F	probably damaging	Het
Nppa	G	A	4: 148,000,871	V13I	probably benign	Het
Olfr1104	G	C	2: 87,022,525	F6L	probably benign	Het
Pde2a	A	G	7: 101,501,037	N228D	probably benign	Het
Pgpep1l	C	T	7: 68,239,067		probably null	Het
Plekhg3	A	G	12: 76,576,004	N673D	probably benign	Het
Plxna4	A	G	6: 32,516,737	S315P	probably benign	Het
Psg21	A	T	7: 18,654,739		probably null	Het
Rnf111	T	C	9: 70,429,607	T925A	probably damaging	Het
Rnf219	A	T	14: 104,479,817	C373*	probably null	Het
Spag9	T	C	11: 94,093,502	F734L	possibly damaging	Het
Tarbp1	A	G	8: 126,450,695	V746A	probably benign	Het
Tmtc1	A	G	6: 148,412,745	F119L	probably benign	Het
Ttc21b	A	G	2: 66,226,900	M576T	probably benign	Het
Usp48	T	A	4: 137,634,921	V765E	probably damaging	Het
Vmn1r20	A	G	6: 57,432,108	S140G	probably benign	Het
Vwde	A	G	6: 13,205,844	S235P	probably damaging	Het
Wapl	A	G	14: 34,692,692	S504G	probably benign	Het
Zfp142	G	A	1: 74,570,217		probably null	Het
Zfp385b	ATCTTCTTCTTCT	ATCTTCTTCTTCTTCT	2: 77,719,648		probably benign	Het
Zfp948	A	G	17: 21,587,551	H335R	probably benign	Het

Other mutations in Wnt5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01590:Wnt5b	APN	6	119440554	missense	possibly damaging	0.70
IGL01822:Wnt5b	APN	6	119433472	missense	probably damaging	1.00
Blizzard	UTSW	6	119446358	missense	probably damaging	1.00
Invierno	UTSW	6	119440311	missense	probably damaging	1.00
luftmensch	UTSW	6	119433852	missense	probably damaging	0.97
R0557:Wnt5b	UTSW	6	119433818	missense	probably damaging	1.00
R0732:Wnt5b	UTSW	6	119446582	nonsense	probably null
R1472:Wnt5b	UTSW	6	119433481	missense	probably damaging	1.00
R1673:Wnt5b	UTSW	6	119446354	missense	probably benign	0.19
R4202:Wnt5b	UTSW	6	119440311	missense	probably damaging	1.00
R5100:Wnt5b	UTSW	6	119440488	missense	probably benign	0.20
R5264:Wnt5b	UTSW	6	119433852	missense	probably damaging	0.97
R5393:Wnt5b	UTSW	6	119440433	missense	probably damaging	1.00
R5394:Wnt5b	UTSW	6	119440322	missense	probably damaging	0.98
R5482:Wnt5b	UTSW	6	119446431	missense	probably benign	0.19
R5741:Wnt5b	UTSW	6	119433729	missense	probably damaging	1.00
R5902:Wnt5b	UTSW	6	119448238	missense	probably benign	0.00
R6005:Wnt5b	UTSW	6	119433654	missense	probably benign	0.04
R6061:Wnt5b	UTSW	6	119433642	missense	probably damaging	0.98
R6208:Wnt5b	UTSW	6	119446512	missense	probably damaging	1.00
R6405:Wnt5b	UTSW	6	119433496	missense	probably benign	0.06
R6478:Wnt5b	UTSW	6	119433790	missense	probably damaging	1.00
R7047:Wnt5b	UTSW	6	119448256	start gained	probably benign
R7338:Wnt5b	UTSW	6	119448131	splice site	probably null
R8044:Wnt5b	UTSW	6	119446358	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTTGCATCTGACAAAGCAACACC -3'
(R):5'- ATGTCGCCTGCAAATGTCAC -3'

Sequencing Primer
(F):5'- ACACCAGTGGAACCTGCAGTG -3'
(R):5'- TGCAAATGTCACGGAGTCTC -3'

Posted On

2018-05-21