Incidental Mutation 'R6482:Klrg1'
ID517165
Institutional Source Beutler Lab
Gene Symbol Klrg1
Ensembl Gene ENSMUSG00000030114
Gene Namekiller cell lectin-like receptor subfamily G, member 1
Synonyms2F1-Ag
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6482 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location122270596-122282882 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 122271453 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 162 (C162*)
Ref Sequence ENSEMBL: ENSMUSP00000032207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032207]
PDB Structure
Structure of NK cell receptor KLRG1 bound to E-cadherin [X-RAY DIFFRACTION]
Structure of NK cell receptor KLRG1 [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000032207
AA Change: C162*
SMART Domains Protein: ENSMUSP00000032207
Gene: ENSMUSG00000030114
AA Change: C162*

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
CLECT 75 184 1.13e-18 SMART
Meta Mutation Damage Score 0.9565 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. The protein encoded by this gene belongs to the killer cell lectin-like receptor (KLR) family, which is a group of transmembrane proteins preferentially expressed in NK cells. Studies in mice suggested that the expression of this gene may be regulated by MHC class I molecules. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for a null allele have no abnormal phenoptype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadvl T C 11: 70,011,562 I415V probably benign Het
Akap8l A G 17: 32,345,396 F6L possibly damaging Het
Ano3 T A 2: 110,697,055 N603Y probably damaging Het
Casp8ap2 T C 4: 32,634,813 S116P probably damaging Het
Ccdc110 A T 8: 45,942,788 Q572L probably benign Het
Chit1 T C 1: 134,143,242 S20P probably damaging Het
Col22a1 G A 15: 71,890,489 P107L possibly damaging Het
Dpys T C 15: 39,841,973 H248R probably damaging Het
Dsg2 A T 18: 20,601,314 K783I possibly damaging Het
Efnb2 A T 8: 8,620,637 V321E probably damaging Het
Fbxo11 A T 17: 88,012,658 Y209N probably benign Het
Gm21936 A G 12: 87,795,795 Y95C probably damaging Het
Gm35315 A T 5: 110,078,089 C495S possibly damaging Het
Hrh1 A G 6: 114,480,763 Q335R possibly damaging Het
Il12rb2 A G 6: 67,356,686 L203P probably damaging Het
Itgav T C 2: 83,794,270 S735P probably damaging Het
Mcc T C 18: 44,445,864 S651G possibly damaging Het
Nkx2-2 T A 2: 147,185,976 I15F probably damaging Het
Nppa G A 4: 148,000,871 V13I probably benign Het
Olfr1104 G C 2: 87,022,525 F6L probably benign Het
Pde2a A G 7: 101,501,037 N228D probably benign Het
Pgpep1l C T 7: 68,239,067 probably null Het
Plekhg3 A G 12: 76,576,004 N673D probably benign Het
Plxna4 A G 6: 32,516,737 S315P probably benign Het
Psg21 A T 7: 18,654,739 probably null Het
Rnf111 T C 9: 70,429,607 T925A probably damaging Het
Rnf219 A T 14: 104,479,817 C373* probably null Het
Spag9 T C 11: 94,093,502 F734L possibly damaging Het
Tarbp1 A G 8: 126,450,695 V746A probably benign Het
Tmtc1 A G 6: 148,412,745 F119L probably benign Het
Ttc21b A G 2: 66,226,900 M576T probably benign Het
Usp48 T A 4: 137,634,921 V765E probably damaging Het
Vmn1r20 A G 6: 57,432,108 S140G probably benign Het
Vwde A G 6: 13,205,844 S235P probably damaging Het
Wapl A G 14: 34,692,692 S504G probably benign Het
Wnt5b A T 6: 119,433,612 L289Q possibly damaging Het
Zfp142 G A 1: 74,570,217 probably null Het
Zfp385b ATCTTCTTCTTCT ATCTTCTTCTTCTTCT 2: 77,719,648 probably benign Het
Zfp948 A G 17: 21,587,551 H335R probably benign Het
Other mutations in Klrg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Klrg1 APN 6 122282752 missense probably benign 0.00
R0766:Klrg1 UTSW 6 122279663 missense probably benign 0.00
R1297:Klrg1 UTSW 6 122273579 missense probably benign 0.12
R1974:Klrg1 UTSW 6 122282762 missense possibly damaging 0.74
R2034:Klrg1 UTSW 6 122279637 critical splice donor site probably null
R4823:Klrg1 UTSW 6 122273533 splice site probably null
R4995:Klrg1 UTSW 6 122278275 missense probably benign 0.00
R5029:Klrg1 UTSW 6 122282735 missense probably benign
R5225:Klrg1 UTSW 6 122271372 makesense probably null
R6389:Klrg1 UTSW 6 122271472 missense probably damaging 0.96
R7958:Klrg1 UTSW 6 122271372 makesense probably null
Predicted Primers PCR Primer
(F):5'- CCCCAGAAAGGTATGCTAATCC -3'
(R):5'- AACAGTTTGTTCCCCTGCTG -3'

Sequencing Primer
(F):5'- CCAGAAAGGTATGCTAATCCTCTGTC -3'
(R):5'- CCCTGCTGTTTTGATGCCTGAG -3'
Posted On2018-05-21