Mutagenetix > Incidental Mutation

Incidental Mutation 'R6482:Rnf111'

517171

Institutional Source

Beutler Lab

Gene Symbol

Rnf111

Ensembl Gene

ENSMUSG00000032217

Gene Name

ring finger 111

Synonyms

Arkadia

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6482 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70425424-70503725 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70429607 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 925 (T925A)

Ref Sequence

ENSEMBL: ENSMUSP00000149445 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034739] [ENSMUST00000113595] [ENSMUST00000213647] [ENSMUST00000215848]

AlphaFold

Q99ML9

Predicted Effect

probably damaging
Transcript: ENSMUST00000034739
AA Change: T933A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000034739
Gene: ENSMUSG00000032217
AA Change: T933A

Domain	Start	End	E-Value	Type
Pfam:RNF111_N	18	290	2.5e-112	PFAM
low complexity region	340	355	N/A	INTRINSIC
low complexity region	503	518	N/A	INTRINSIC
low complexity region	623	632	N/A	INTRINSIC
low complexity region	692	707	N/A	INTRINSIC
low complexity region	744	758	N/A	INTRINSIC
low complexity region	759	776	N/A	INTRINSIC
low complexity region	820	837	N/A	INTRINSIC
low complexity region	924	935	N/A	INTRINSIC
RING	937	977	3e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000113595
AA Change: T933A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000109225
Gene: ENSMUSG00000032217
AA Change: T933A

Domain	Start	End	E-Value	Type
Pfam:RNF111_N	18	290	1.8e-97	PFAM
low complexity region	340	355	N/A	INTRINSIC
low complexity region	503	518	N/A	INTRINSIC
low complexity region	623	632	N/A	INTRINSIC
low complexity region	692	707	N/A	INTRINSIC
low complexity region	744	758	N/A	INTRINSIC
low complexity region	759	776	N/A	INTRINSIC
low complexity region	820	837	N/A	INTRINSIC
low complexity region	924	935	N/A	INTRINSIC
RING	937	977	3e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213208

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213647
AA Change: T924A

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213996

Predicted Effect

probably damaging
Transcript: ENSMUST00000215848
AA Change: T925A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.6%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear RING-domain containing E3 ubiquitin ligase. This protein interacts with the transforming growth factor (TGF) -beta/NODAL signaling pathway by promoting the ubiquitination and proteosomal degradation of negative regulators, like SMAD proteins, and thereby enhances TGF-beta target-gene transcription. As a modulator of the nodal signaling cascade, this gene plays a critical role in the induction of mesoderm during embryonic development. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele fail to develop anterior structures and midline with failure to develop anterior endoderm, node and mesendoderm. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadvl	T	C	11: 70,011,562	I415V	probably benign	Het
Akap8l	A	G	17: 32,345,396	F6L	possibly damaging	Het
Ano3	T	A	2: 110,697,055	N603Y	probably damaging	Het
Casp8ap2	T	C	4: 32,634,813	S116P	probably damaging	Het
Ccdc110	A	T	8: 45,942,788	Q572L	probably benign	Het
Chit1	T	C	1: 134,143,242	S20P	probably damaging	Het
Col22a1	G	A	15: 71,890,489	P107L	possibly damaging	Het
Dpys	T	C	15: 39,841,973	H248R	probably damaging	Het
Dsg2	A	T	18: 20,601,314	K783I	possibly damaging	Het
Efnb2	A	T	8: 8,620,637	V321E	probably damaging	Het
Fbxo11	A	T	17: 88,012,658	Y209N	probably benign	Het
Gm21936	A	G	12: 87,795,795	Y95C	probably damaging	Het
Gm35315	A	T	5: 110,078,089	C495S	possibly damaging	Het
Hrh1	A	G	6: 114,480,763	Q335R	possibly damaging	Het
Il12rb2	A	G	6: 67,356,686	L203P	probably damaging	Het
Itgav	T	C	2: 83,794,270	S735P	probably damaging	Het
Klrg1	G	T	6: 122,271,453	C162*	probably null	Het
Mcc	T	C	18: 44,445,864	S651G	possibly damaging	Het
Nkx2-2	T	A	2: 147,185,976	I15F	probably damaging	Het
Nppa	G	A	4: 148,000,871	V13I	probably benign	Het
Olfr1104	G	C	2: 87,022,525	F6L	probably benign	Het
Pde2a	A	G	7: 101,501,037	N228D	probably benign	Het
Pgpep1l	C	T	7: 68,239,067		probably null	Het
Plekhg3	A	G	12: 76,576,004	N673D	probably benign	Het
Plxna4	A	G	6: 32,516,737	S315P	probably benign	Het
Psg21	A	T	7: 18,654,739		probably null	Het
Rnf219	A	T	14: 104,479,817	C373*	probably null	Het
Spag9	T	C	11: 94,093,502	F734L	possibly damaging	Het
Tarbp1	A	G	8: 126,450,695	V746A	probably benign	Het
Tmtc1	A	G	6: 148,412,745	F119L	probably benign	Het
Ttc21b	A	G	2: 66,226,900	M576T	probably benign	Het
Usp48	T	A	4: 137,634,921	V765E	probably damaging	Het
Vmn1r20	A	G	6: 57,432,108	S140G	probably benign	Het
Vwde	A	G	6: 13,205,844	S235P	probably damaging	Het
Wapl	A	G	14: 34,692,692	S504G	probably benign	Het
Wnt5b	A	T	6: 119,433,612	L289Q	possibly damaging	Het
Zfp142	G	A	1: 74,570,217		probably null	Het
Zfp385b	ATCTTCTTCTTCT	ATCTTCTTCTTCTTCT	2: 77,719,648		probably benign	Het
Zfp948	A	G	17: 21,587,551	H335R	probably benign	Het

Other mutations in Rnf111

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02473:Rnf111	APN	9	70440858	missense	probably damaging	1.00
IGL02567:Rnf111	APN	9	70459005	missense	probably damaging	1.00
R0052:Rnf111	UTSW	9	70476389	missense	probably benign	0.00
R0245:Rnf111	UTSW	9	70453831	splice site	probably benign
R0760:Rnf111	UTSW	9	70429678	missense	probably damaging	1.00
R1327:Rnf111	UTSW	9	70453816	missense	possibly damaging	0.60
R1778:Rnf111	UTSW	9	70476112	missense	probably benign	0.00
R1884:Rnf111	UTSW	9	70476238	missense	probably damaging	0.99
R1892:Rnf111	UTSW	9	70476374	missense	probably damaging	1.00
R2261:Rnf111	UTSW	9	70476391	missense	probably benign
R2762:Rnf111	UTSW	9	70476045	missense	possibly damaging	0.82
R3980:Rnf111	UTSW	9	70442325	missense	probably damaging	1.00
R4577:Rnf111	UTSW	9	70429584	nonsense	probably null
R4631:Rnf111	UTSW	9	70450396	missense	probably benign	0.07
R4804:Rnf111	UTSW	9	70430957	missense	possibly damaging	0.70
R5153:Rnf111	UTSW	9	70476140	missense	probably benign	0.35
R5500:Rnf111	UTSW	9	70476043	missense	possibly damaging	0.94
R5546:Rnf111	UTSW	9	70459096	missense	probably benign	0.05
R5975:Rnf111	UTSW	9	70429580	missense	probably damaging	1.00
R6395:Rnf111	UTSW	9	70476410	missense	possibly damaging	0.95
R7056:Rnf111	UTSW	9	70453675	missense	possibly damaging	0.60
R7239:Rnf111	UTSW	9	70469373	missense	probably damaging	1.00
R7444:Rnf111	UTSW	9	70440843	missense	probably damaging	1.00
R7618:Rnf111	UTSW	9	70503332	start gained	probably benign
R8068:Rnf111	UTSW	9	70457941	missense	probably benign	0.00
R8323:Rnf111	UTSW	9	70475922	missense	probably benign	0.03
R8444:Rnf111	UTSW	9	70457941	missense	probably benign	0.00
R8997:Rnf111	UTSW	9	70476263	missense	probably damaging	0.98
R9108:Rnf111	UTSW	9	70429564	missense	probably damaging	1.00
R9774:Rnf111	UTSW	9	70427021	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGTGACCAGTTGATCCATTTG -3'
(R):5'- GACTTCCAGGAGTCAGTAATTAATTGG -3'

Sequencing Primer
(F):5'- GAATCAATCACCTATCTGTGGTGCTG -3'
(R):5'- CATGACAGTGTTGTGTAGGAATTAAG -3'

Posted On

2018-05-21